Morpholino
MO2-scgn
- ID
- ZDB-MRPHLNO-200505-1
- Name
- MO2-scgn
- Previous Names
- None
- Target
- Sequence
-
5' - GGTTGGCAAAAGCACTGTCCATGAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-scgn
No data available
Phenotype
Phenotype resulting from MO2-scgn
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-scgn
1 - 5 of 8 Show all
Citations
- Liu, Z., Tan, S., Zhou, L., Chen, L., Liu, M., Wang, W., Tang, Y., Yang, Q., Chi, S., Jiang, P., Zhang, Y., Cui, Y., Qin, J., Hu, X., Li, S., Liu, Q., Chen, L., Li, S., Burstein, E., Li, W., Zhang, X., Mo, X., Jia, D. (2023) SCGN deficiency is a risk factor for autism spectrum disorder. Signal transduction and targeted therapy. 8:33
- Qin, J., Liu, Q., Liu, Z., Pan, Y.Z., Sifuentes-Dominguez, L., Stepien, K.P., Wang, Y., Tu, Y., Tan, S., Wang, Y., Sun, Q., Mo, X., Rizo, J., Burstein, E., Jia, D. (2020) Structural and mechanistic insights into secretagogin-mediated exocytosis. Proceedings of the National Academy of Sciences of the United States of America. 117:6559-6570
- Sifuentes-Dominguez, L.F., Li, H., Llano, E., Liu, Z., Singla, A., Patel, A.S., Kathania, M., Khoury, A., Norris, N., Rios, J.J., Starokadomskyy, P., Park, J.Y., Gopal, P., Liu, Q., Tan, S., Chan, L., Ross, T., Harrison, S., Venuprasad, K., Baker, L.A., Jia, D., Burstein, E. (2019) SCGN deficiency results in colitis susceptibility. eLIFE. 8:
1 - 3 of 3
Show