Morpholino

MO1-cthrc1a

ID
ZDB-MRPHLNO-191101-1
Name
MO1-cthrc1a
Previous Names
None
Target
Sequence
5' - CAGTTAGTTTGGTCGCTCCTGCTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cthrc1a
No data available
Phenotype
Phenotype resulting from MO1-cthrc1a
Phenotype Fish Figures
blastoderm increased thickness, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
blastoderm margin irregular spatial pattern, abnormal AB + MO1-cthrc1a Fig. 2 from Cheng et al., 2019
blastoderm cell decreased adhesivity, abnormal AB + MO1-cthrc1a Fig. S5 from Cheng et al., 2019
blastoderm segmentation delayed, abnormal AB + MO1-cthrc1a Fig. 1 with imageFig. 2 from Cheng et al., 2019
cell migration involved in gastrulation disrupted, abnormal AB + MO1-cthrc1a Fig. 4Fig. MovieS1 from Cheng et al., 2019
convergent extension involved in axis elongation disrupted, abnormal AB + MO1-cthrc1a Fig. 1 with imageFig. 3 with image from Cheng et al., 2019
epiboly disrupted, abnormal AB + MO1-cthrc1a Fig. 1 with imageFig. 2Fig. S3 from Cheng et al., 2019
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
mesoderm migration involved in gastrulation disrupted, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
neural plate increased width, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
notochord increased width, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
paraxial mesoderm condensed, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
shield aplastic, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
spinal cord axon regeneration decreased occurrence, abnormal mps1Tg + MO1-cthrc1a Fig. 6 from Tsata et al., 2020
swimming decreased occurrence, abnormal mps1Tg + MO1-cthrc1a Fig. 6 from Tsata et al., 2020
whole organism anterior-posterior axis curved, abnormal AB + MO1-cthrc1a Fig. 3 with image from Cheng et al., 2019
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-cthrc1a Fig. 1 with image from Cheng et al., 2019
Phenotype of all Fish created by or utilizing MO1-cthrc1a
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis curved, abnormal AB + MO1-cthrc1a standard conditions Fig. 3 with image from Cheng et al., 2019
mesoderm migration involved in gastrulation disrupted, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
neural plate increased width, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
notochord increased width, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
blastoderm cell decreased adhesivity, abnormal AB + MO1-cthrc1a standard conditions Fig. S5 from Cheng et al., 2019
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
epiboly disrupted, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with imageFig. 2Fig. S3 from Cheng et al., 2019
blastoderm segmentation delayed, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with imageFig. 2 from Cheng et al., 2019
convergent extension involved in axis elongation disrupted, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with imageFig. 3 with image from Cheng et al., 2019
paraxial mesoderm condensed, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
shield aplastic, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
blastoderm margin irregular spatial pattern, abnormal AB + MO1-cthrc1a standard conditions Fig. 2 from Cheng et al., 2019
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
blastoderm increased thickness, abnormal AB + MO1-cthrc1a standard conditions Fig. 1 with image from Cheng et al., 2019
cell migration involved in gastrulation disrupted, abnormal AB + MO1-cthrc1a standard conditions Fig. 4Fig. MovieS1 from Cheng et al., 2019
swimming decreased occurrence, abnormal mps1Tg + MO1-cthrc1a standard conditions Fig. 6 from Tsata et al., 2020
spinal cord axon regeneration decreased occurrence, abnormal mps1Tg + MO1-cthrc1a standard conditions Fig. 6 from Tsata et al., 2020
Citations