Morpholino

MO2-lnc.tie1

ID

ZDB-MRPHLNO-190717-2

Name

MO2-lnc.tie1

Previous Names

tie1AS-Elavl-bMO2 (1)

Target

lnc.tie1 (1)

Sequence

5' - TTACTGAAAGTCATCTGTTCTGCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-lnc.tie1

No data available

Phenotype

Phenotype resulting from MO2-lnc.tie1

No data available

Phenotype of all Fish created by or utilizing MO2-lnc.tie1

Phenotype	Fish	Conditions	Figures
primordial midbrain channel tie1 expression increased amount, abnormal	WT + MO1-lnc.tie1 + MO2-lnc.tie1	control	Fig. 4 from Chowdhury et al., 2018
whole organism posterior region tie1 expression increased amount, abnormal	WT + MO1-lnc.tie1 + MO2-lnc.tie1	control	Fig. 5 from Chowdhury et al., 2018
whole organism posterior region tie1 expression amount, ameliorated	WT + MO1-lnc.tie1 + MO2-lnc.tie1	chemical treatment by environment: SB 505124	Fig. 5 from Chowdhury et al., 2018
head tie1 expression amount, ameliorated	WT + MO1-lnc.tie1 + MO2-lnc.tie1	chemical treatment by environment: SB 505124	Fig. 5 from Chowdhury et al., 2018
head lnc.tie1 expression decreased amount, abnormal	WT + MO1-lnc.tie1 + MO2-lnc.tie1	standard conditions	Fig. 3 from Chowdhury et al., 2018
head tie1 expression increased amount, abnormal	WT + MO1-lnc.tie1 + MO2-lnc.tie1	control	Fig. 3, Fig. 4, Fig. 5 from Chowdhury et al., 2018
whole organism tie1 expression amount, ameliorated	WT + MO1-lnc.tie1 + MO2-lnc.tie1	chemical treatment by environment: SB 505124	Fig. 5 from Chowdhury et al., 2018
whole organism tie1 expression increased amount, abnormal	WT + MO1-lnc.tie1 + MO2-lnc.tie1	control	Fig. 5 from Chowdhury et al., 2018
ventricular zone decreased size, abnormal	s843Tg + MO1-lnc.tie1 + MO2-lnc.tie1	standard conditions	Fig. 4, Fig. 5 from Chowdhury et al., 2018
eye decreased size, abnormal	s843Tg + MO1-lnc.tie1 + MO2-lnc.tie1	standard conditions	Fig. 4, Fig. 5 from Chowdhury et al., 2018
ventricular zone size, ameliorated	s843Tg + MO1-lnc.tie1 + MO2-lnc.tie1	chemical treatment by environment: SB 505124	Fig. 5 from Chowdhury et al., 2018
primordial midbrain channel size, ameliorated	s843Tg + MO1-lnc.tie1 + MO2-lnc.tie1	chemical treatment by environment: SB 505124	Fig. 5 from Chowdhury et al., 2018
primordial midbrain channel increased size, abnormal	s843Tg + MO1-lnc.tie1 + MO2-lnc.tie1	standard conditions	Fig. 4, Fig. 5 from Chowdhury et al., 2018
eye size, ameliorated	s843Tg + MO1-lnc.tie1 + MO2-lnc.tie1	chemical treatment by environment: SB 505124	Fig. 5 from Chowdhury et al., 2018
primordial midbrain channel endothelial cell amount, ameliorated	ci5Tg; ubs1Tg + MO1-lnc.tie1 + MO2-lnc.tie1	chemical treatment by environment: SB 505124	Fig. 6 from Chowdhury et al., 2018
primordial midbrain channel endothelial cell increased amount, abnormal	ci5Tg; ubs1Tg + MO1-lnc.tie1 + MO2-lnc.tie1	standard conditions	Fig. 6 from Chowdhury et al., 2018

Citations