Morpholino

MO2-tmem33

ID
ZDB-MRPHLNO-190716-5
Name
MO2-tmem33
Previous Names
  • tmem33 sp3 morpholino (1)
Target
Sequence
5' - TTATAGGAGAACATGACTCACCCAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tmem33
No data available
Phenotype
Phenotype resulting from MO2-tmem33
No data available
Phenotype of all Fish created by or utilizing MO2-tmem33
Phenotype Fish Conditions Figures
dorsal aorta blood vessel endothelial cell notch1b expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel Notch signaling pathway decreased occurrence, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 4 with image from Savage et al., 2019
dorsal aorta Notch signaling pathway decreased occurrence, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell notch1b expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta blood vessel endothelial cell hey2 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell dll4 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta blood vessel endothelial cell her12 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell her12 expression decreased amount, abnormal WT + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel blood vessel endothelial cell Venus expression decreased amount, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta blood vessel endothelial cell Venus expression decreased amount, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel Notch signaling pathway decreased occurrence, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
spinal cord Venus expression decreased amount, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
dorsal aorta Notch signaling pathway decreased occurrence, abnormal qmc61Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 6 with image from Savage et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal sh467Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell filopodium assembly decreased occurrence, abnormal sh467Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell has fewer parts of type endothelial tip cell filopodium, abnormal sh467Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell spade-shaped, abnormal y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
dorsal longitudinal anastomotic vessel split, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
dorsal longitudinal anastomotic vessel sprouting angiogenesis decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
intersegmental vessel cell migration involved in sprouting angiogenesis decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
cardiovascular system lacks all parts of type vascular lymphangioblast, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
intersegmental vessel sprouting angiogenesis decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
lymph vessel development decreased occurrence, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
cardiovascular system lacks all parts of type thoracic duct, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
dorsal longitudinal anastomotic vessel malformed, abnormal hu5333Tg; y1Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 1 with image from Savage et al., 2019
endothelial tip cell regulation of cytosolic calcium ion concentration decreased occurrence, abnormal sh392Tg; ubs3Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
endothelial tip cell calcium-mediated signaling decreased occurrence, abnormal sh392Tg; ubs3Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
intersegmental vessel endothelial tip cell GCaMP expression decreased amount, abnormal sh392Tg; ubs3Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
endothelial tip cell regulation of store-operated calcium channel activity decreased occurrence, abnormal sh392Tg; ubs3Tg + MO1-tmem33 + MO2-tmem33 standard conditions Fig. 2 with image from Savage et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.