Morpholino

MO2-pip5k1ab

ID

ZDB-MRPHLNO-190709-2

Name

MO2-pip5k1ab

Previous Names

None

Target

Sequence

5' - GGACGCCATTTTGATTCGGTTATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-pip5k1ab

No data available

Phenotype

Phenotype resulting from MO2-pip5k1ab

Phenotype	Fish	Figures
kidney cystic, abnormal	TU + MO2-pip5k1ab	Fig. 2 from Xu et al., 2018
pronephric glomerular capsule epithelium apical-basal polarity, abnormal	TU + MO2-pip5k1ab	Fig. S4 from Xu et al., 2018
pronephric glomerular capsule epithelium apical side ab1-atp1a1 labeling mislocalised, abnormal	TU + MO2-pip5k1ab	Fig. S4 from Xu et al., 2018
pronephric tubule ciliary basal body mislocalised, abnormal	TU + MO2-pip5k1ab	Fig. S5 from Xu et al., 2018
pronephric tubule ciliary basal body-plasma membrane docking decreased occurrence, abnormal	TU + MO2-pip5k1ab	Fig. 3 from Xu et al., 2018
pronephric tubule cilium malformed, abnormal	TU + MO2-pip5k1ab	Fig. 3 from Xu et al., 2018
pronephric tubule filamentous actin malformed, abnormal	TU + MO2-pip5k1ab	Fig. 3 from Xu et al., 2018

Phenotype of all Fish created by or utilizing MO2-pip5k1ab

Phenotype	Fish	Conditions	Figures
kidney cystic, abnormal	TU + MO2-pip5k1ab	standard conditions	Fig. 2 from Xu et al., 2018
pronephric tubule cilium malformed, abnormal	TU + MO2-pip5k1ab	standard conditions	Fig. 3 from Xu et al., 2018
pronephric tubule ciliary basal body-plasma membrane docking decreased occurrence, abnormal	TU + MO2-pip5k1ab	standard conditions	Fig. 3 from Xu et al., 2018
pronephric tubule ciliary basal body mislocalised, abnormal	TU + MO2-pip5k1ab	standard conditions	Fig. S5 from Xu et al., 2018
pronephric glomerular capsule epithelium apical-basal polarity, abnormal	TU + MO2-pip5k1ab	standard conditions	Fig. S4 from Xu et al., 2018
pronephric glomerular capsule epithelium apical side ab1-atp1a1 labeling mislocalised, abnormal	TU + MO2-pip5k1ab	standard conditions	Fig. S4 from Xu et al., 2018
pronephric tubule filamentous actin malformed, abnormal	TU + MO2-pip5k1ab	standard conditions	Fig. 3 from Xu et al., 2018
kidney cystic, exacerbated	TU + MO1-inpp5e + MO2-pip5k1ab	standard conditions	Fig. S6 from Xu et al., 2018
pronephric duct EGFP expression decreased amount, abnormal	tju10Tg + MO2-pip5k1ab	standard conditions	Fig. 3 from Xu et al., 2018
pronephric duct apical region mCherry expression decreased amount, abnormal	tju12Tg + MO2-pip5k1ab	standard conditions	Fig. 3 from Xu et al., 2018

Citations