Morpholino

MO5-tbx20

ID
ZDB-MRPHLNO-190405-3
Name
MO5-tbx20
Previous Names
None
Target
Sequence
5' - ACTATTCTCAACAGCAGGAACCTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-tbx20
Expressed Gene Anatomy Figures
myl7 Fig. S2 from Meng et al., 2018
prok2 Fig. 3 from Meng et al., 2018
prokr1a Fig. 7 from Meng et al., 2018
prokr1b Fig. 7 from Meng et al., 2018
Phenotype
Phenotype resulting from MO5-tbx20
Phenotype Fish Figures
intersegmental vessel EGFP expression decreased distribution, abnormal y1Tg + MO5-tbx20 Fig. 7,  Fig. S4 from Meng et al., 2018
intersegmental vessel decreased length, abnormal y1Tg + MO5-tbx20 Fig. 1,  Fig. S4 from Meng et al., 2018
intersegmental vessel morphology, abnormal y1Tg + MO5-tbx20 Fig. 1,  Fig. 7,  Fig. S4 from Meng et al., 2018
intersegmental vessel EGFP expression spatial pattern, abnormal y1Tg + MO5-tbx20 Fig. 7,  Fig. S4 from Meng et al., 2018
sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO5-tbx20 Fig. 1,  Fig. 7 from Meng et al., 2018
subintestinal vein decreased amount, abnormal y1Tg + MO5-tbx20 Fig. 1,  Fig. 7 from Meng et al., 2018
subintestinal vein decreased length, abnormal y1Tg + MO5-tbx20 Fig. 1,  Fig. 7 from Meng et al., 2018
subintestinal vein morphology, abnormal y1Tg + MO5-tbx20 Fig. 1,  Fig. 7 from Meng et al., 2018
trunk prok2 expression decreased amount, abnormal AB + MO5-tbx20 Fig. 3 from Meng et al., 2018
trunk prokr1a expression decreased amount, abnormal AB + MO5-tbx20 Fig. 7 from Meng et al., 2018
vasculature EGFP expression decreased distribution, abnormal y1Tg + MO5-tbx20 Fig. 1 from Meng et al., 2018
vasculature EGFP expression spatial pattern, abnormal y1Tg + MO5-tbx20 Fig. 1 from Meng et al., 2018
Phenotype of all Fish created by or utilizing MO5-tbx20
Phenotype Fish Conditions Figures
trunk prok2 expression decreased amount, abnormal AB + MO5-tbx20 standard conditions Fig. 3 from Meng et al., 2018
trunk prokr1a expression decreased amount, abnormal AB + MO5-tbx20 standard conditions Fig. 7 from Meng et al., 2018
intersegmental vessel morphology, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1,  Fig. 7,  Fig. S4 from Meng et al., 2018
subintestinal vein morphology, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1,  Fig. 7 from Meng et al., 2018
intersegmental vessel EGFP expression decreased distribution, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 7,  Fig. S4 from Meng et al., 2018
intersegmental vessel EGFP expression spatial pattern, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 7,  Fig. S4 from Meng et al., 2018
subintestinal vein decreased length, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1,  Fig. 7 from Meng et al., 2018
sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1,  Fig. 7 from Meng et al., 2018
vasculature EGFP expression decreased distribution, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1 from Meng et al., 2018
vasculature EGFP expression spatial pattern, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1 from Meng et al., 2018
subintestinal vein decreased amount, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1,  Fig. 7 from Meng et al., 2018
intersegmental vessel decreased length, abnormal y1Tg + MO5-tbx20 standard conditions Fig. 1,  Fig. S4 from Meng et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.