Morpholino

MO1-washc4

ID
ZDB-MRPHLNO-181217-2
Name
MO1-washc4
Previous Names
None
Target
Sequence
5' - CAGGAGATAATGAATCCACAGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-washc4
Phenotype
Phenotype resulting from MO1-washc4
Phenotype Fish Figures
autophagy decreased occurrence, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
blood circulation decreased magnitude, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
heart edematous, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
heart contraction decreased frequency, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
involuntary skeletal muscle contraction decreased occurrence, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
myotome skeletal muscle cell has extra parts of type skeletal muscle cell vesicle, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle mitochondrion malformed, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle sarcomere disorganized, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle sarcomere organization decreased process quality, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle cell has fewer parts of type skeletal muscle cell skeletal muscle myofibril, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
skeletal muscle fiber development decreased process quality, abnormal WT + MO1-washc4 Fig. 6 with image from Kustermann et al., 2018
thigmotaxis decreased occurrence, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
whole organism washc4 expression decreased amount, abnormal WT + MO1-washc4 Fig. 5 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism atf4a expression increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism Ab7-sqstm1 labeling increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism ppp1r15a expression increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
whole organism hspa5 expression increased amount, abnormal WT + MO1-washc4 Fig. 7 with image from Kustermann et al., 2018
Phenotype of all Fish created by or utilizing MO1-washc4
Phenotype Fish Conditions Figures
blood circulation decreased magnitude, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
skeletal muscle sarcomere disorganized, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO1-washc4 control Fig. 7 with image from Kustermann et al., 2018
skeletal muscle sarcomere organization decreased process quality, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
thigmotaxis decreased occurrence, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
whole organism Ab7-sqstm1 labeling increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
heart contraction decreased frequency, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
myotome skeletal muscle cell has extra parts of type skeletal muscle cell vesicle, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
involuntary skeletal muscle contraction decreased occurrence, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
skeletal muscle fiber development decreased process quality, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
autophagy decreased occurrence, abnormal WT + MO1-washc4 control Fig. 7 with image from Kustermann et al., 2018
whole organism atf4a expression increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
autophagy decreased occurrence, abnormal WT + MO1-washc4 chemical treatment by environment: ammonium chloride Fig. 7 with image from Kustermann et al., 2018
skeletal muscle mitochondrion malformed, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO1-washc4 chemical treatment by environment: ammonium chloride Fig. 7 with image from Kustermann et al., 2018
heart edematous, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
whole organism washc4 expression decreased amount, abnormal WT + MO1-washc4 standard conditions Fig. 5 with image from Kustermann et al., 2018
skeletal muscle cell has fewer parts of type skeletal muscle cell skeletal muscle myofibril, abnormal WT + MO1-washc4 standard conditions Fig. 6 with image from Kustermann et al., 2018
whole organism hspa5 expression increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
whole organism ppp1r15a expression increased amount, abnormal WT + MO1-washc4 standard conditions Fig. 7 with image from Kustermann et al., 2018
Citations