Morpholino

MO4-vcp

ID
ZDB-MRPHLNO-181217-1
Name
MO4-vcp
Previous Names
None
Target
Sequence
5' - AAGCCATATTGCTTCTCCCGCAAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-vcp
Expressed Gene Anatomy Figures
vcp Fig. 1 with image from Kustermann et al., 2018
Phenotype
Phenotype resulting from MO4-vcp
Phenotype Fish Figures
autophagy decreased occurrence, abnormal WT + MO4-vcp Fig. 3 with image from Kustermann et al., 2018
blood circulation decreased magnitude, abnormal WT + MO4-vcp Fig. 1 with image from Kustermann et al., 2018
heart edematous, abnormal WT + MO4-vcp Fig. 1 with image from Kustermann et al., 2018
heart contraction decreased frequency, abnormal WT + MO4-vcp Fig. 1 with image from Kustermann et al., 2018
heart contraction decreased magnitude, abnormal WT + MO4-vcp Fig. 1 with image from Kustermann et al., 2018
involuntary skeletal muscle contraction decreased occurrence, abnormal WT + MO4-vcp Fig. 1 with image from Kustermann et al., 2018
myotome skeletal muscle malformed, abnormal WT + MO4-vcp Fig. 1 with image,  Fig. 2 with image from Kustermann et al., 2018
myotome skeletal muscle cell has extra parts of type skeletal muscle cell vesicle, abnormal WT + MO4-vcp Fig. 2 with image from Kustermann et al., 2018
proteasome-mediated ubiquitin-dependent protein catabolic process decreased occurrence, abnormal WT + MO4-vcp Fig. 3 with image from Kustermann et al., 2018
skeletal muscle mitochondrion malformed, abnormal WT + MO4-vcp Fig. 2 with image from Kustermann et al., 2018
skeletal muscle skeletal muscle myofibril disorganized, abnormal WT + MO4-vcp Fig. 2 with image from Kustermann et al., 2018
skeletal muscle skeletal myofibril assembly decreased process quality, abnormal WT + MO4-vcp Fig. 2 with image from Kustermann et al., 2018
skeletal muscle cell Z disc malformed, abnormal WT + MO4-vcp Fig. 2 with image from Kustermann et al., 2018
thigmotaxis decreased occurrence, abnormal WT + MO4-vcp Fig. 1 with image from Kustermann et al., 2018
whole organism vcp expression decreased amount, abnormal WT + MO4-vcp Fig. 1 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO4-vcp Fig. 3 with image from Kustermann et al., 2018
whole organism Ab7-sqstm1 labeling increased amount, abnormal WT + MO4-vcp Fig. 3 with image from Kustermann et al., 2018
whole organism Ab4-ub labeling increased amount, abnormal WT + MO4-vcp Fig. 3 with image from Kustermann et al., 2018
Phenotype of all Fish created by or utilizing MO4-vcp
Phenotype Fish Conditions Figures
involuntary skeletal muscle contraction decreased occurrence, abnormal WT + MO4-vcp standard conditions Fig. 1 with image from Kustermann et al., 2018
whole organism Ab4-ub labeling increased amount, abnormal WT + MO4-vcp control Fig. 3 with image from Kustermann et al., 2018
heart edematous, abnormal WT + MO4-vcp standard conditions Fig. 1 with image from Kustermann et al., 2018
whole organism Ab4-ub labeling increased amount, abnormal WT + MO4-vcp chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 with image from Kustermann et al., 2018
autophagy decreased occurrence, abnormal WT + MO4-vcp chemical treatment by environment: ammonium chloride Fig. 3 with image from Kustermann et al., 2018
heart contraction decreased magnitude, abnormal WT + MO4-vcp standard conditions Fig. 1 with image from Kustermann et al., 2018
skeletal muscle skeletal myofibril assembly decreased process quality, abnormal WT + MO4-vcp standard conditions Fig. 2 with image from Kustermann et al., 2018
skeletal muscle mitochondrion malformed, abnormal WT + MO4-vcp standard conditions Fig. 2 with image from Kustermann et al., 2018
whole organism Ab7-sqstm1 labeling increased amount, abnormal WT + MO4-vcp control Fig. 3 with image from Kustermann et al., 2018
proteasome-mediated ubiquitin-dependent protein catabolic process decreased occurrence, abnormal WT + MO4-vcp control Fig. 3 with image from Kustermann et al., 2018
blood circulation decreased magnitude, abnormal WT + MO4-vcp standard conditions Fig. 1 with image from Kustermann et al., 2018
autophagy decreased occurrence, abnormal WT + MO4-vcp control Fig. 3 with image from Kustermann et al., 2018
skeletal muscle skeletal muscle myofibril disorganized, abnormal WT + MO4-vcp standard conditions Fig. 2 with image from Kustermann et al., 2018
whole organism vcp expression decreased amount, abnormal WT + MO4-vcp standard conditions Fig. 1 with image from Kustermann et al., 2018
myotome skeletal muscle malformed, abnormal WT + MO4-vcp standard conditions Fig. 1 with image,  Fig. 2 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO4-vcp control Fig. 3 with image from Kustermann et al., 2018
thigmotaxis decreased occurrence, abnormal WT + MO4-vcp standard conditions Fig. 1 with image from Kustermann et al., 2018
myotome skeletal muscle cell has extra parts of type skeletal muscle cell vesicle, abnormal WT + MO4-vcp standard conditions Fig. 2 with image from Kustermann et al., 2018
whole organism ab1-map1lc3 labeling increased amount, abnormal WT + MO4-vcp chemical treatment by environment: ammonium chloride Fig. 3 with image from Kustermann et al., 2018
proteasome-mediated ubiquitin-dependent protein catabolic process decreased occurrence, abnormal WT + MO4-vcp chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 with image from Kustermann et al., 2018
heart contraction decreased frequency, abnormal WT + MO4-vcp standard conditions Fig. 1 with image from Kustermann et al., 2018
skeletal muscle cell Z disc malformed, abnormal WT + MO4-vcp standard conditions Fig. 2 with image from Kustermann et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.