Morpholino

MO2-brca2

ID
ZDB-MRPHLNO-181101-1
Name
MO2-brca2
Previous Names
None
Target
Sequence
5' - TTTCAAACATGCTGCCATGAGTGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. There is a mismatch in the published morpholino sequence, the above sequence is correct.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-brca2
Phenotype
Phenotype resulting from MO2-brca2
Phenotype of all Fish created by or utilizing MO2-brca2
Phenotype Fish Conditions Figures
pronephric podocyte wt1b expression absent, abnormal WT + MO2-brca2 chemical treatment by environment: DAPT Fig. 11 with image from Kroeger et al., 2017
pronephric glomerulus development decreased occurrence, abnormal WT + MO2-brca2 standard conditions Fig. 7 with image from Kroeger et al., 2017
interrenal primordium nr5a1a expression increased distribution, abnormal WT + MO2-brca2 chemical treatment by environment: DAPT Fig. 11 with image from Kroeger et al., 2017
pronephros lacks parts or has fewer parts of type pronephric podocyte, abnormal WT + MO2-brca2 chemical treatment by environment: DAPT Fig. 11 with image from Kroeger et al., 2017
interrenal primordium nr5a1a expression increased distribution, abnormal WT + MO2-brca2 heat shock Fig. 11 with image from Kroeger et al., 2017
pronephric podocyte wt1b expression decreased amount, abnormal WT + MO2-brca2 standard conditions Fig. 7 with image from Kroeger et al., 2017
interrenal primordium nr5a1a expression increased distribution, abnormal WT + MO2-brca2 standard conditions Fig. 7 with image from Kroeger et al., 2017
interrenal primordium nr5a1a expression increased amount, abnormal WT + MO2-brca2 standard conditions Fig. 7 with image from Kroeger et al., 2017
pronephric podocyte wt1b expression absent, abnormal WT + MO2-brca2 heat shock Fig. 11 with image from Kroeger et al., 2017
pronephros lacks parts or has fewer parts of type pronephric podocyte, abnormal WT + MO2-brca2 heat shock Fig. 11 with image from Kroeger et al., 2017
interrenal primordium increased size, abnormal WT + MO2-brca2 standard conditions Fig. 7 with image from Kroeger et al., 2017
pronephros lacks parts or has fewer parts of type pronephric podocyte, abnormal WT + MO2-brca2 standard conditions Fig. 7 with image from Kroeger et al., 2017
pronephric podocyte wt1b expression absent, abnormal kca3Tg; kca4Tg + MO2-brca2 heat shock Fig. 11 with image from Kroeger et al., 2017
interrenal primordium nr5a1a expression spatial pattern, ameliorated kca3Tg; kca4Tg + MO2-brca2 heat shock Fig. 11 with image from Kroeger et al., 2017
pronephros lacks parts or has fewer parts of type pronephric podocyte, abnormal kca3Tg; kca4Tg + MO2-brca2 heat shock Fig. 11 with image from Kroeger et al., 2017
Citations