Morpholino

MO1-fignl1

ID
ZDB-MRPHLNO-180904-1
Name
MO1-fignl1
Previous Names
None
Target
Sequence
5' - TCGTCCAGGTGTGCTCTGCTCATGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fignl1
No data available
Phenotype
Phenotype resulting from MO1-fignl1
Phenotype Fish Figures
CaP motoneuron axon increased branchiness, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
CaP motoneuron axon truncated, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
CaP motoneuron axon extension arrested, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
caudal fin atrophied, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
hatching decreased occurrence, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
locomotion involved in locomotory behavior decreased process quality, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
locomotion involved in locomotory behavior process quality, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
neuromuscular junction development decreased occurrence, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
pectoral fin atrophied, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
Rohon-Beard neuron innervation decreased occurrence, abnormal WT + MO1-fignl1 Fig. 4 with image from Fassier et al., 2018
secondary motor neuron axon defasciculated, abnormal WT + MO1-fignl1 Fig. 3 from Atkins et al., 2019
Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon mislocalised, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon morphology, abnormal WT + MO1-fignl1 Fig. 3,  Fig. 8 from Atkins et al., 2019
secondary motor neuron axon split, abnormal WT + MO1-fignl1 Fig. 3 from Atkins et al., 2019
secondary motor neuron axon extension arrested, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon guidance process quality, abnormal WT + MO1-fignl1 Fig. 3 from Atkins et al., 2019
secondary motor neuron growth cone increased size, abnormal ml2Tg + MO1-fignl1 Fig. 6 with image from Fassier et al., 2018
whole organism curved, abnormal WT + MO1-fignl1 Fig. 3 with image from Fassier et al., 2018
Phenotype of all Fish created by or utilizing MO1-fignl1
Phenotype Fish Conditions Figures
locomotion involved in locomotory behavior process quality, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon morphology, abnormal WT + MO1-fignl1 control Fig. 3,  Fig. 8 from Atkins et al., 2019
CaP motoneuron axon truncated, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
hatching decreased occurrence, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
locomotion involved in locomotory behavior decreased process quality, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon extension arrested, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon split, abnormal WT + MO1-fignl1 control Fig. 3 from Atkins et al., 2019
CaP motoneuron axon increased branchiness, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
CaP motoneuron axon extension arrested, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
neuromuscular junction development decreased occurrence, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon morphology, ameliorated WT + MO1-fignl1 chemical treatment by environment: ciliobrevin D Fig. 8 from Atkins et al., 2019
secondary motor neuron axon guidance process quality, abnormal WT + MO1-fignl1 control Fig. 3 from Atkins et al., 2019
caudal fin atrophied, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
whole organism curved, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
pectoral fin atrophied, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
secondary motor neuron axon defasciculated, abnormal WT + MO1-fignl1 control Fig. 3 from Atkins et al., 2019
Fig. 3 with image from Fassier et al., 2018
Rohon-Beard neuron innervation decreased occurrence, abnormal WT + MO1-fignl1 control Fig. 4 with image from Fassier et al., 2018
secondary motor neuron axon mislocalised, abnormal WT + MO1-fignl1 control Fig. 3 with image from Fassier et al., 2018
secondary motor neuron growth cone increased size, abnormal ml2Tg + MO1-fignl1 control Fig. 6 with image from Fassier et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.