Morpholino

MO1-golgb1

ID

ZDB-MRPHLNO-171011-3

Name

MO1-golgb1

Previous Names

None

Target

golgb1 (1)

Sequence

5' - AACATGGCTGACCTGCAAGAAAATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-golgb1

No data available

Phenotype

Phenotype resulting from MO1-golgb1

Phenotype	Fish	Figures
brain edematous, abnormal	WT + MO1-golgb1 + MO4-tp53	Fig. 1 from Bergen et al., 2017
ciliated olfactory receptor neuron 9+2 non-motile cilium malformed, abnormal	WT + MO1-golgb1	Fig. 4 from Bergen et al., 2017
determination of heart left/right asymmetry decreased process quality, abnormal	twu34Tg + MO1-golgb1	Fig. 5 from Bergen et al., 2017
ependymal cell cilium increased length, abnormal	WT + MO1-golgb1	Fig. 2 from Bergen et al., 2017
eye decreased size, abnormal	WT + MO1-golgb1 + MO4-tp53	Fig. 1 from Bergen et al., 2017
heart edematous, abnormal	WT + MO1-golgb1	Fig. 1 from Bergen et al., 2017
heart tube mislocalised, abnormal	twu34Tg + MO1-golgb1	Fig. 5 from Bergen et al., 2017
neural tube has fewer parts of type neural tube cilium, abnormal	WT + MO1-golgb1	Fig. 2 from Bergen et al., 2017
neural tube cilium increased length, abnormal	WT + MO1-golgb1	Fig. 2 from Bergen et al., 2017
neural tube cilium assembly process quality, abnormal	WT + MO1-golgb1	Fig. 2 from Bergen et al., 2017
olfactory pit cilium assembly process quality, abnormal	WT + MO1-golgb1	Fig. 4 from Bergen et al., 2017
post-vent region kinked, abnormal	WT + MO1-golgb1	Fig. 1 from Bergen et al., 2017

Phenotype of all Fish created by or utilizing MO1-golgb1

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	WT + MO1-golgb1	standard conditions	Fig. 1 from Bergen et al., 2017
neural tube cilium increased length, abnormal	WT + MO1-golgb1	standard conditions	Fig. 2 from Bergen et al., 2017
brain edematous, abnormal	WT + MO1-golgb1	standard conditions	Fig. 1 from Bergen et al., 2017
ependymal cell cilium increased length, abnormal	WT + MO1-golgb1	standard conditions	Fig. 2 from Bergen et al., 2017
olfactory pit cilium assembly process quality, abnormal	WT + MO1-golgb1	standard conditions	Fig. 4 from Bergen et al., 2017
heart edematous, abnormal	WT + MO1-golgb1	standard conditions	Fig. 1 from Bergen et al., 2017
neural tube cilium assembly process quality, abnormal	WT + MO1-golgb1	standard conditions	Fig. 2 from Bergen et al., 2017
post-vent region kinked, abnormal	WT + MO1-golgb1	standard conditions	Fig. 1 from Bergen et al., 2017
ciliated olfactory receptor neuron 9+2 non-motile cilium malformed, abnormal	WT + MO1-golgb1	standard conditions	Fig. 4 from Bergen et al., 2017
neural tube has fewer parts of type neural tube cilium, abnormal	WT + MO1-golgb1	standard conditions	Fig. 2 from Bergen et al., 2017
post-vent region kinked, abnormal	WT + MO1-golgb1 + MO4-tp53	standard conditions	Fig. 1 from Bergen et al., 2017
heart edematous, abnormal	WT + MO1-golgb1 + MO4-tp53	standard conditions	Fig. 1 from Bergen et al., 2017
brain edematous, abnormal	WT + MO1-golgb1 + MO4-tp53	standard conditions	Fig. 1 from Bergen et al., 2017
eye decreased size, abnormal	WT + MO1-golgb1 + MO4-tp53	standard conditions	Fig. 1 from Bergen et al., 2017
determination of heart left/right asymmetry decreased process quality, abnormal	twu34Tg + MO1-golgb1	standard conditions	Fig. 5 from Bergen et al., 2017
heart tube mislocalised, abnormal	twu34Tg + MO1-golgb1	standard conditions	Fig. 5 from Bergen et al., 2017

Citations