Morpholino

MO6-lbx2

ID

ZDB-MRPHLNO-170915-3

Name

MO6-lbx2

Previous Names

MO-SA (1)

Target

lbx2 (1)

Sequence

5' - TGTGTTCACGACCTTAAAATGGAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-lbx2

No data available

Phenotype

Phenotype resulting from MO6-lbx2

No data available

Phenotype of all Fish created by or utilizing MO6-lbx2

Phenotype	Fish	Conditions	Figures
margin ventral region eve1 expression decreased distribution, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1, Fig. 5 from Lu et al., 2014
trunk ventral region absent, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	control	Fig. 2 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal	AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2	standard conditions	Fig. 1, Fig. 5 from Lu et al., 2014

Citations