Morpholino

MO1-cln3

ID
ZDB-MRPHLNO-170816-1
Name
MO1-cln3
Previous Names
None
Target
Sequence
5' - CATTGCGACTTTCACAGGAGAAATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cln3
No data available
Phenotype
Phenotype resulting from MO1-cln3
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
axon extension disrupted, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain morphology, abnormal TL + MO1-cln3 Fig. 3 with image,  Fig. 6 with image from Wager et al., 2016
brain astrocyte increased amount, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain axon aggregated, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain axon disorganized, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain cell apoptotic, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
brain lysosome hypertrophic, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
brain neuron decreased amount, abnormal knu3Tg + MO1-cln3 Fig. 6 with image from Wager et al., 2016
brain development disrupted, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
cranial nerve II decreased width, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
eye mitochondrion morphology, abnormal TL + MO1-cln3 Fig. 9 with image from Wager et al., 2016
forebrain apoptotic body increased amount, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
fourth ventricle increased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
hindbrain size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
larval locomotory behavior process quality, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
midbrain decreased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
neuron morphology, abnormal knu3Tg + MO1-cln3 Fig. 6 with image from Wager et al., 2016
optic tectum axon absent, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 Fig. 4 from Wager et al., 2016
pericardium increased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
post-vent region curved, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
regulation of mitochondrial membrane potential disrupted, abnormal TL + MO1-cln3 Fig. 9 with image from Wager et al., 2016
retina decreased size, abnormal TL + MO1-cln3 Fig. 3 with image,  Fig. 7 with image from Wager et al., 2016
retina cell apoptotic, abnormal TL + MO1-cln3 Fig. 8 with image from Wager et al., 2016
retina cell population proliferation disrupted, abnormal TL + MO1-cln3 Fig. 7 with image from Wager et al., 2016
spinal cord astrocyte increased amount, abnormal TL + MO1-cln3 Fig. 6 with image from Wager et al., 2016
whole organism dead, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
whole organism decreased life span, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
whole organism lysosome increased size, abnormal TL + MO1-cln3 Fig. 9 with image from Wager et al., 2016
whole organism thigmotaxis disrupted, abnormal TL + MO1-cln3 Fig. 5 from Wager et al., 2016
yolk increased size, abnormal TL + MO1-cln3 Fig. 3 with image from Wager et al., 2016
Phenotype of all Fish created by or utilizing MO1-cln3
Phenotype Fish Conditions Figures
larval locomotory behavior process quality, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
whole organism dead, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
forebrain apoptotic body increased amount, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
brain morphology, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
yolk increased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
retina cell population proliferation disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 7 with image from Wager et al., 2016
axon extension disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
midbrain decreased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
retina cell apoptotic, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
fourth ventricle increased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
brain axon aggregated, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain cell apoptotic, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
brain development disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 4 from Wager et al., 2016
regulation of mitochondrial membrane potential disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 9 with image from Wager et al., 2016
brain lysosome hypertrophic, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
cranial nerve II decreased width, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
whole organism lysosome increased size, abnormal TL + MO1-cln3 standard conditions Fig. 9 with image from Wager et al., 2016
hindbrain size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
whole organism decreased life span, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
post-vent region curved, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
optic tectum axon absent, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain astrocyte increased amount, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain axon disorganized, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
whole organism thigmotaxis disrupted, abnormal TL + MO1-cln3 standard conditions Fig. 5 from Wager et al., 2016
pericardium increased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image from Wager et al., 2016
retina decreased size, abnormal TL + MO1-cln3 standard conditions Fig. 3 with image,  Fig. 7 with image from Wager et al., 2016
eye mitochondrion morphology, abnormal TL + MO1-cln3 standard conditions Fig. 9 with image from Wager et al., 2016
apoptotic process increased occurrence, abnormal TL + MO1-cln3 standard conditions Fig. 8 with image from Wager et al., 2016
spinal cord astrocyte increased amount, abnormal TL + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
optic tectum regulation of neuronal action potential disrupted, abnormal TL + MO1-cln3 + MO4-tp53 standard conditions Fig. 4 from Wager et al., 2016
brain morphology, abnormal knu3Tg + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
neuron morphology, abnormal knu3Tg + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
brain neuron decreased amount, abnormal knu3Tg + MO1-cln3 standard conditions Fig. 6 with image from Wager et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.