Morpholino

MO8-nrg1

ID
ZDB-MRPHLNO-170808-3
Name
MO8-nrg1
Previous Names
None
Target
Sequence
5' - CTTTGCCTGCTTTCACCTCAGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO8-nrg1
Expressed Gene Anatomy Figures
crestin Fig. 4 from Pu et al., 2017
ret Fig. 4 from Pu et al., 2017
sox10 Fig. 4 from Pu et al., 2017
Phenotype
Phenotype resulting from MO8-nrg1
Phenotype Fish Figures
caudal fin kinked, abnormal AB + MO8-nrg1 Fig. 2 from Pu et al., 2017
cranial nerve X morphology, abnormal AB + MO8-nrg1 Fig. 5 from Pu et al., 2017
embryo development disrupted, abnormal AB + MO8-nrg1 Fig. 2 from Pu et al., 2017
enteric nervous system crestin expression decreased amount, abnormal AB + MO8-nrg1 Fig. 4 from Pu et al., 2017
enteric nervous system ret expression decreased amount, abnormal AB + MO8-nrg1 Fig. 4 from Pu et al., 2017
enteric nervous system sox10 expression decreased amount, abnormal AB + MO8-nrg1 Fig. 4 from Pu et al., 2017
enteric neuron decreased amount, abnormal AB + MO8-nrg1 Fig. 3 from Pu et al., 2017
head decreased size, abnormal AB + MO8-nrg1 Fig. 2 from Pu et al., 2017
intestine neuron projection disorganized, abnormal AB + MO8-nrg1 Fig. 5 from Pu et al., 2017
intestine neuron projection increased thickness, abnormal AB + MO8-nrg1 Fig. 5 from Pu et al., 2017
intestine neuron projection shortened, abnormal AB + MO8-nrg1 Fig. 5 from Pu et al., 2017
pericardium edematous, abnormal AB + MO8-nrg1 Fig. 2 from Pu et al., 2017
whole organism decreased life span, abnormal AB + MO8-nrg1 Fig. 2 from Pu et al., 2017
whole organism morphology, abnormal AB + MO8-nrg1 Fig. 2 from Pu et al., 2017
Phenotype of all Fish created by or utilizing MO8-nrg1
Phenotype Fish Conditions Figures
enteric nervous system ret expression decreased amount, abnormal AB + MO8-nrg1 standard conditions Fig. 4 from Pu et al., 2017
intestine neuron projection disorganized, abnormal AB + MO8-nrg1 standard conditions Fig. 5 from Pu et al., 2017
intestine neuron projection shortened, abnormal AB + MO8-nrg1 standard conditions Fig. 5 from Pu et al., 2017
pericardium edematous, abnormal AB + MO8-nrg1 standard conditions Fig. 2 from Pu et al., 2017
enteric nervous system sox10 expression decreased amount, abnormal AB + MO8-nrg1 standard conditions Fig. 4 from Pu et al., 2017
caudal fin kinked, abnormal AB + MO8-nrg1 standard conditions Fig. 2 from Pu et al., 2017
enteric nervous system crestin expression decreased amount, abnormal AB + MO8-nrg1 standard conditions Fig. 4 from Pu et al., 2017
cranial nerve X morphology, abnormal AB + MO8-nrg1 standard conditions Fig. 5 from Pu et al., 2017
whole organism morphology, abnormal AB + MO8-nrg1 standard conditions Fig. 2 from Pu et al., 2017
whole organism decreased life span, abnormal AB + MO8-nrg1 standard conditions Fig. 2 from Pu et al., 2017
intestine neuron projection increased thickness, abnormal AB + MO8-nrg1 standard conditions Fig. 5 from Pu et al., 2017
embryo development disrupted, abnormal AB + MO8-nrg1 standard conditions Fig. 2 from Pu et al., 2017
enteric neuron decreased amount, abnormal AB + MO8-nrg1 standard conditions Fig. 3 from Pu et al., 2017
head decreased size, abnormal AB + MO8-nrg1 standard conditions Fig. 2 from Pu et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.