Morpholino

MO2-zdhhc13

ID
ZDB-MRPHLNO-170209-2
Name
MO2-zdhhc13
Previous Names
  • zdhhc13-5'UTR-MO (1)
Target
Sequence
5' - CTGTACGAGGTTATCCGTGATTTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zdhhc13
Expressed Gene Anatomy Figures
chrd Fig. 2 from Chen et al., 2014
dlx3b Fig. 2 from Chen et al., 2014
eve1 Fig. 2 from Chen et al., 2014
foxi1 Fig. 2 from Chen et al., 2014
gsc Fig. 2 from Chen et al., 2014
sox3 Fig. 2 from Chen et al., 2014
tbxta Fig. 2 from Chen et al., 2014
Phenotype
Phenotype resulting from MO2-zdhhc13
Phenotype Fish Figures
brain increased size, abnormal AB + MO2-zdhhc13 Fig. 1 from Chen et al., 2014
head increased size, abnormal AB + MO2-zdhhc13 Fig. 1 from Chen et al., 2014
heart decreased functionality, abnormal AB + MO2-zdhhc13 Fig. 1 from Chen et al., 2014
mesoderm dorsal region chrd expression increased distribution, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
neuroectoderm dlx3b expression increased distribution, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
neuroectoderm sox3 expression increased distribution, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
presumptive ectoderm ventral region foxi1 expression decreased distribution, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
presumptive ventral mesoderm eve1 expression decreased distribution, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
somite distended, abnormal AB + MO2-zdhhc13 Fig. 1 from Chen et al., 2014
ventral fin fold decreased thickness, abnormal AB + MO2-zdhhc13 Fig. 1 from Chen et al., 2014
whole organism eve1 expression decreased amount, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
whole organism tbxta expression decreased amount, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
whole organism foxi1 expression decreased amount, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
whole organism sox3 expression increased amount, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
whole organism chrd expression increased amount, abnormal AB + MO2-zdhhc13 Fig. 2 from Chen et al., 2014
Phenotype of all Fish created by or utilizing MO2-zdhhc13
Phenotype Fish Conditions Figures
neuroectoderm sox3 expression increased distribution, abnormal AB + MO2-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
head increased size, abnormal AB + MO2-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
whole organism eve1 expression decreased amount, abnormal AB + MO2-zdhhc13 control Fig. 2 from Chen et al., 2014
whole organism chrd expression increased amount, abnormal AB + MO2-zdhhc13 control Fig. 2 from Chen et al., 2014
heart decreased functionality, abnormal AB + MO2-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
presumptive ectoderm ventral region foxi1 expression decreased distribution, abnormal AB + MO2-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
mesoderm dorsal region chrd expression increased distribution, abnormal AB + MO2-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
whole organism tbxta expression decreased amount, abnormal AB + MO2-zdhhc13 control Fig. 2 from Chen et al., 2014
whole organism foxi1 expression decreased amount, abnormal AB + MO2-zdhhc13 control Fig. 2 from Chen et al., 2014
presumptive ventral mesoderm eve1 expression decreased distribution, abnormal AB + MO2-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
neuroectoderm dlx3b expression increased distribution, abnormal AB + MO2-zdhhc13 standard conditions Fig. 2 from Chen et al., 2014
ventral fin fold decreased thickness, abnormal AB + MO2-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
somite distended, abnormal AB + MO2-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
whole organism sox3 expression increased amount, abnormal AB + MO2-zdhhc13 control Fig. 2 from Chen et al., 2014
brain increased size, abnormal AB + MO2-zdhhc13 standard conditions Fig. 1 from Chen et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.