Morpholino

MO1-mtch2

ID
ZDB-MRPHLNO-170109-3
Name
MO1-mtch2
Previous Names
  • MO e1-i1 (1)
Target
Sequence
5' - GCGGATTGTGTAAATCCTACCTGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mtch2
Expressed Gene Anatomy Figures
fabp2 Fig. 3 from Landgraf et al., 2016
fabp10a Fig. 3 from Landgraf et al., 2016
mtch2 Fig. 2 from Landgraf et al., 2016
Phenotype
Phenotype resulting from MO1-mtch2
Phenotype Fish Figures
digestive tract development disrupted, abnormal AB + MO1-mtch2 Fig. 3 from Landgraf et al., 2016
eye decreased size, abnormal AB + MO1-mtch2 Fig. 4 from Landgraf et al., 2016
fat cell differentiation disrupted, abnormal AB + MO1-mtch2 Fig. 4 from Landgraf et al., 2016
intestine fabp2 expression decreased distribution, abnormal AB + MO1-mtch2 Fig. 3 from Landgraf et al., 2016
liver fabp10a expression decreased distribution, abnormal AB + MO1-mtch2 Fig. 3 from Landgraf et al., 2016
liver development disrupted, abnormal AB + MO1-mtch2 Fig. 3 from Landgraf et al., 2016
visceral fat fat cell decreased amount, abnormal AB + MO1-mtch2 Fig. 4 from Landgraf et al., 2016
whole organism fabp2 expression decreased amount, abnormal AB + MO1-mtch2 Fig. 3 from Landgraf et al., 2016
whole organism fabp10a expression decreased amount, abnormal AB + MO1-mtch2 Fig. 3 from Landgraf et al., 2016
whole organism mtch2 expression decreased amount, abnormal AB + MO1-mtch2 Fig. 2 from Landgraf et al., 2016
Phenotype of all Fish created by or utilizing MO1-mtch2
Phenotype Fish Conditions Figures
whole organism fabp10a expression decreased amount, abnormal AB + MO1-mtch2 standard conditions Fig. 3 from Landgraf et al., 2016
intestine fabp2 expression decreased distribution, abnormal AB + MO1-mtch2 standard conditions Fig. 3 from Landgraf et al., 2016
liver development disrupted, abnormal AB + MO1-mtch2 standard conditions Fig. 3 from Landgraf et al., 2016
liver fabp10a expression decreased distribution, abnormal AB + MO1-mtch2 standard conditions Fig. 3 from Landgraf et al., 2016
digestive tract development disrupted, abnormal AB + MO1-mtch2 standard conditions Fig. 3 from Landgraf et al., 2016
eye decreased size, abnormal AB + MO1-mtch2 standard conditions Fig. 4 from Landgraf et al., 2016
whole organism mtch2 expression decreased amount, abnormal AB + MO1-mtch2 standard conditions Fig. 2 from Landgraf et al., 2016
visceral fat fat cell decreased amount, abnormal AB + MO1-mtch2 standard conditions Fig. 4 from Landgraf et al., 2016
whole organism fabp2 expression decreased amount, abnormal AB + MO1-mtch2 standard conditions Fig. 3 from Landgraf et al., 2016
fat cell differentiation disrupted, abnormal AB + MO1-mtch2 standard conditions Fig. 4 from Landgraf et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.