Morpholino

MO2-vdra

ID

ZDB-MRPHLNO-161129-4

Name

MO2-vdra

Previous Names

None

Target

vdra (1)

Sequence

5' - ACGGCACTATTTTCCGTAAGCATCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-vdra

Expressed Gene	Anatomy	Figures
kdrl	ventral wall of dorsal aorta whole organism	Fig. 1 from Cortes et al., 2016
runx1	ventral wall of dorsal aorta whole organism	Fig. 1 from Cortes et al., 2016

Phenotype

Phenotype resulting from MO2-vdra

Phenotype	Fish	Figures
hematopoietic stem cell proliferation disrupted, abnormal	WT + MO2-vdra	Fig. 1 from Cortes et al., 2016
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO2-vdra	Fig. 1 from Cortes et al., 2016
ventral wall of dorsal aorta has extra parts of type hematopoietic stem cell, abnormal	nu15Tg + MO2-vdra	Fig. 2 from Cortes et al., 2015
ventral wall of dorsal aorta has extra parts of type hematopoietic multipotent progenitor cell, abnormal	nu15Tg + MO2-vdra	Fig. 2 from Cortes et al., 2015
ventral wall of dorsal aorta has fewer parts of type hematopoietic multipotent progenitor cell, abnormal	WT + MO2-vdra	Fig. 1 from Cortes et al., 2016
whole organism runx1 expression decreased amount, abnormal	WT + MO2-vdra	Fig. 1 from Cortes et al., 2016

Phenotype of all Fish created by or utilizing MO2-vdra

Phenotype	Fish	Conditions	Figures
hematopoietic stem cell proliferation disrupted, abnormal	WT + MO2-vdra	standard conditions	Fig. 1 from Cortes et al., 2016
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO2-vdra	standard conditions	Fig. 1 from Cortes et al., 2016
whole organism runx1 expression decreased amount, abnormal	WT + MO2-vdra	standard conditions	Fig. 1 from Cortes et al., 2016
ventral wall of dorsal aorta has fewer parts of type hematopoietic multipotent progenitor cell, abnormal	WT + MO2-vdra	standard conditions	Fig. 1 from Cortes et al., 2016
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal	nu15Tg + MO2-vdra	chemical treatment by environment: calciol	Fig. 2 from Cortes et al., 2015
ventral wall of dorsal aorta has extra parts of type hematopoietic stem cell, abnormal	nu15Tg + MO2-vdra	control	Fig. 2 from Cortes et al., 2015
ventral wall of dorsal aorta has extra parts of type hematopoietic multipotent progenitor cell, abnormal	nu15Tg + MO2-vdra	control	Fig. 2 from Cortes et al., 2015
ventral wall of dorsal aorta has fewer parts of type hematopoietic multipotent progenitor cell, abnormal	nu15Tg + MO2-vdra	chemical treatment by environment: calciol	Fig. 2 from Cortes et al., 2015
hematopoietic stem cell proliferation disrupted, abnormal	pd27Tg; sd2Tg; zf169Tg; zf71Tg + MO2-vdra	standard conditions	Fig. 1 from Cortes et al., 2016
ventral wall of dorsal aorta has fewer parts of type hematopoietic multipotent progenitor cell, abnormal	pd27Tg; sd2Tg; zf169Tg; zf71Tg + MO2-vdra	standard conditions	Fig. 1 from Cortes et al., 2016

Citations