Morpholino

MO1-racgap1

ID

ZDB-MRPHLNO-161121-1

Name

MO1-racgap1

Previous Names

None

Target

racgap1 (1)

Sequence

5' - AGGGAAATAATCTTACCAGTCTTCCACGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-racgap1

No data available

Phenotype

Phenotype resulting from MO1-racgap1

Phenotype	Fish	Figures
cell binucleate, abnormal	WT + MO1-racgap1	Fig. 2 from Warga et al., 2016
cell increased size, abnormal	WT + MO1-racgap1	Fig. 6 from Warga et al., 2016
cell multinucleate, abnormal	WT + MO1-racgap1	Fig. 6 from Warga et al., 2016
cytokinesis disrupted, abnormal	WT + MO1-racgap1	Fig. 6 from Warga et al., 2016
head apoptotic, abnormal	WT + MO1-racgap1	Fig. 2 from Warga et al., 2016
mitotic cell cycle increased duration, abnormal	WT + MO1-racgap1	Fig. 6 from Warga et al., 2016
whole organism opacity, abnormal	WT + MO1-racgap1	Fig. 2 from Warga et al., 2016
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-racgap1	Fig. 2 from Warga et al., 2016
whole organism apoptotic process increased occurrence, abnormal	WT + MO1-racgap1	Fig. 6 from Warga et al., 2016

Phenotype of all Fish created by or utilizing MO1-racgap1

Phenotype	Fish	Conditions	Figures
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-racgap1	standard conditions	Fig. 2 from Warga et al., 2016
whole organism opacity, abnormal	WT + MO1-racgap1	standard conditions	Fig. 2 from Warga et al., 2016
cell binucleate, abnormal	WT + MO1-racgap1	standard conditions	Fig. 2 from Warga et al., 2016
cell multinucleate, abnormal	WT + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
cytokinesis disrupted, abnormal	WT + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
cell increased size, abnormal	WT + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
whole organism apoptotic process increased occurrence, abnormal	WT + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
mitotic cell cycle increased duration, abnormal	WT + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
head apoptotic, abnormal	WT + MO1-racgap1	standard conditions	Fig. 2 from Warga et al., 2016
cell mitotic prophase arrested, abnormal	cdc20^ta94/ta94 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
cell binucleate, abnormal	cdc20^ta94/ta94 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
cell mitotic metaphase arrested, abnormal	cdc20^ta94/ta94 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
whole organism apoptotic process increased occurrence, abnormal	cdc20^ta94/ta94 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
mitotic cell cycle disrupted, abnormal	cdc20^ta94/ta94 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
mitotic cell cycle lacking processual parts cytokinesis, abnormal	fbxo5^ti245/ti245 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
cell increased size, abnormal	fbxo5^ti245/ti245 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
mitotic cell cycle disrupted, abnormal	fbxo5^ti245/ti245 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016
cell polyploid, abnormal	fbxo5^ti245/ti245 + MO1-racgap1	standard conditions	Fig. 6 from Warga et al., 2016

Citations