Morpholino

MO1-nansa

ID

ZDB-MRPHLNO-160907-1

Name

MO1-nansa

Previous Names

Target

Sequence

5' - AGGGAAATATTGGACCTTTTTGGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-nansa

No data available

Phenotype

Phenotype resulting from MO1-nansa

Phenotype	Fish	Figures
basihyal cartilage absent, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
ceratobranchial cartilage absent, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
embryonic skeletal system development disrupted, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
ethmoid cartilage morphology, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
ethmoid cartilage shortened, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
head decreased size, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
Meckel's cartilage aplastic/hypoplastic, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
palatoquadrate cartilage morphology, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
parachordal cartilage morphology, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
pericardium edematous, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016
trabecula cranii morphology, abnormal	WT + MO1-nansa	Fig. 5 from van Karnebeek et al., 2016

Phenotype of all Fish created by or utilizing MO1-nansa

Phenotype	Fish	Conditions	Figures
ethmoid cartilage shortened, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
ethmoid cartilage morphology, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
ceratobranchial cartilage absent, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
palatoquadrate cartilage morphology, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
pericardium edematous, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
Meckel's cartilage morphology, ameliorated	WT + MO1-nansa	chemical treatment: sialic acid	Fig. 5 from van Karnebeek et al., 2016
head decreased size, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
trabecula cranii morphology, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
embryonic skeletal system development disrupted, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
Meckel's cartilage aplastic/hypoplastic, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
parachordal cartilage morphology, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016
basihyal cartilage absent, abnormal	WT + MO1-nansa	standard conditions	Fig. 5 from van Karnebeek et al., 2016

Citations