Morpholino

MO3-pax4

ID

ZDB-MRPHLNO-160621-49

Name

MO3-pax4

Previous Names

Target

Sequence

5' - AGACCTGCCGGAGTACATGGTTACT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-pax4

No data available

Phenotype

Phenotype resulting from MO3-pax4

Phenotype	Fish	Figures
endocrine pancreas EGFP expression decreased distribution, abnormal	nl1Tg + MO3-pax4	Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal	nl1Tg + MO3-pax4	Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal	nl1Tg + MO3-pax4	Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal	nl1Tg + MO3-pax4	Fig. S10 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal	jh1Tg; jh2Tg + MO3-pax4	Fig. S15 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal	jh1Tg; jh2Tg + MO3-pax4	Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal	jh1Tg; jh2Tg + MO3-pax4	Fig. 1 from O'Hare et al., 2016

Phenotype of all Fish created by or utilizing MO3-pax4

Phenotype	Fish	Conditions	Figures
endocrine pancreas decreased size, abnormal	nl1Tg + MO3-pax4	standard conditions	Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal	nl1Tg + MO3-pax4	standard conditions	Fig. S10 from O'Hare et al., 2016
endocrine pancreas EGFP expression decreased distribution, abnormal	nl1Tg + MO3-pax4	standard conditions	Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal	nl1Tg + MO3-pax4	standard conditions	Fig. S10 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal	jh1Tg; jh2Tg + MO3-pax4	standard conditions	Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal	jh1Tg; jh2Tg + MO3-pax4	standard conditions	Fig. 1 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal	jh1Tg; jh2Tg + MO3-pax4	chemical treatment by environment: glucose	Fig. 4 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal	jh1Tg; jh2Tg + MO3-pax4	chemical treatment by environment: glucose	Fig. S15 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal	jh1Tg; jh2Tg + MO3-pax4	control	Fig. S15 from O'Hare et al., 2016
response to glucose decreased process quality, abnormal	jh1Tg; jh2Tg + MO3-pax4	chemical treatment by environment: glucose	Fig. 4 from O'Hare et al., 2016
pancreatic B cell regeneration decreased rate, abnormal	jh4Tg + MO3-pax4	chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole	Fig. 5 from O'Hare et al., 2016

Citations