Morpholino

MO1-adgrb1b

ID

ZDB-MRPHLNO-160413-3

Name

MO1-adgrb1b

Previous Names

1 and 2 exons (1)

Target

adgrb1b (1)

Sequence

5' - CTAGAACTCTAACACACTTACTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-adgrb1b

No data available

Phenotype

Phenotype resulting from MO1-adgrb1b

No data available

Phenotype of all Fish created by or utilizing MO1-adgrb1b

Phenotype	Fish	Conditions	Figures
brain engulfment of apoptotic cell process quality, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b	control	Fig. 6 from Mazaheri et al., 2014
brain apoptotic cell clearance decreased occurrence, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b	control	Fig. 4 from Mazaheri et al., 2014
brain engulfment of apoptotic cell decreased efficacy, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b	control	Fig. 5 from Mazaheri et al., 2014
brain apoptotic cell clearance process quality, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b	control	Fig. 6 from Mazaheri et al., 2014
brain phagolysosome assembly involved in apoptotic cell clearance increased duration, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b	control	Fig. 5 from Mazaheri et al., 2014
brain engulfment of apoptotic cell increased duration, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO2-adgrb1b	control	Fig. 5 from Mazaheri et al., 2014
brain engulfment of apoptotic cell process quality, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1	control	Fig. 6 from Mazaheri et al., 2014
brain apoptotic cell clearance decreased occurrence, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1	control	Fig. 4 from Mazaheri et al., 2014
brain apoptotic cell clearance process quality, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1	control	Fig. 6 from Mazaheri et al., 2014
brain phagolysosome assembly involved in apoptotic cell clearance increased duration, abnormal	hdb2Tg; hdb6Tg + MO1-adgrb1b + MO1-havcr1 + MO2-adgrb1b + MO2-havcr1	control	Fig. 5 from Mazaheri et al., 2014
microglial cell phagocytic vesicle diameter, ameliorated	slc37a2^{t30301/t30301}; zf149Tg + MO1-adgrb1b + MO1-havcr1	standard conditions	Fig. 2 from Villani et al., 2019
microglial cell phagocytosis, engulfment decreased occurrence, abnormal	slc37a2^{t30301/t30301}; zf149Tg + MO1-adgrb1b + MO1-havcr1	standard conditions	Fig. 2 from Villani et al., 2019
microglial cell size, ameliorated	slc37a2^{t30301/t30301}; zf149Tg + MO1-adgrb1b + MO1-havcr1	standard conditions	Fig. 2 from Villani et al., 2019

Citations