Morpholino

MO2-ins

ID
ZDB-MRPHLNO-160331-1
Name
MO2-ins
Previous Names
None
Target
Sequence
5' - CCTCTACTTGACTTTCTTACCCAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ins
Expressed Gene Anatomy Figures
pdx1 Fig. 4 with image from Ye et al., 2016
Phenotype
Phenotype resulting from MO2-ins
Phenotype of all Fish created by or utilizing MO2-ins
Phenotype Fish Conditions Figures
pancreatic A cell differentiation decreased occurrence, abnormal WT + MO2-ins standard conditions Fig. 5 with image from Ye et al., 2016
whole organism pdx1 expression increased amount, abnormal WT + MO2-ins standard conditions Fig. 4 with image from Ye et al., 2016
endoderm EGFP expression decreased amount, abnormal jh1Tg + MO2-ins standard conditions Fig. 4 with image from Ye et al., 2016
type B pancreatic cell differentiation premature, abnormal jh1Tg + MO2-ins standard conditions Fig. 4 with image from Ye et al., 2016
primary islet pancreatic B cell decreased amount, abnormal jh2Tg + MO2-ins standard conditions Fig. S11 from O'Hare et al., 2016
pancreatic B cell increased amount, abnormal jh1Tg; jh2Tg + MO2-ins standard conditions Fig. 2 from O'Hare et al., 2016
pancreatic B cell increased area, abnormal jh1Tg; jh2Tg + MO2-ins standard conditions Fig. 1 from O'Hare et al., 2016
pancreatic B cell mCherry expression increased distribution, abnormal jh1Tg; jh2Tg + MO2-ins standard conditions Fig. S3 from O'Hare et al., 2016
pancreatic B cell increased amount, abnormal s892Tg + MO2-ins standard conditions Fig. 4 with imageFig. 5 with image from Ye et al., 2016
pancreatic A cell decreased amount, abnormal s892Tg + MO2-ins standard conditions Fig. 5 with image from Ye et al., 2016
pancreatic B cell regeneration increased occurrence, abnormal s892Tg + MO2-ins chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 6 with image from Ye et al., 2016
regenerating tissue pancreatic B cell increased amount, abnormal s892Tg + MO2-ins chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 6 with image from Ye et al., 2016
insulin secreting cell increased amount, abnormal s892Tg + MO2-ins standard conditions Fig. 5 with image from Ye et al., 2016
primary islet pdx1 expression increased amount, abnormal s892Tg + MO2-ins standard conditions Fig. 4 with image from Ye et al., 2016
endoderm pdx1 expression increased amount, abnormal s892Tg + MO2-ins standard conditions Fig. 4 with image from Ye et al., 2016
glucagon secreting cell decreased amount, abnormal s892Tg + MO2-ins standard conditions Fig. 5 with image from Ye et al., 2016
pancreatic A cell regeneration decreased occurrence, abnormal s892Tg + MO2-ins chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 6 with image from Ye et al., 2016
Citations