Morpholino

MO2-nr1h3

ID
ZDB-MRPHLNO-160301-5
Name
MO2-nr1h3
Previous Names
  • lxr MO (1)
Target
Sequence
5' - TCTCCTGTTTCACTTCTGCCATCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nr1h3
Expressed Gene Anatomy Figures
cyp51 Fig. S2 from Pinto et al., 2016
elovl2 Fig. S2 from Pinto et al., 2016
fads2 Fig. S2 from Pinto et al., 2016
grk7a Fig. S2 from Pinto et al., 2016
guca1b Fig. S2 from Pinto et al., 2016
guca1d Fig. S2 from Pinto et al., 2016
guca1g Fig. S2 from Pinto et al., 2016
hmgcra Fig. S2 from Pinto et al., 2016
Phenotype
Phenotype resulting from MO2-nr1h3
Phenotype Fish Figures
whole organism elovl2 expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
whole organism fads2 expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
whole organism hmgcra expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
whole organism guca1g expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
whole organism guca1d expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
whole organism guca1b expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
whole organism cyp51 expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
whole organism grk7a expression decreased amount, abnormal WT + MO2-nr1h3 Fig. S2 from Pinto et al., 2016
Phenotype of all Fish created by or utilizing MO2-nr1h3
Phenotype Fish Conditions Figures
whole organism guca1g expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
whole organism grk7a expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
whole organism elovl2 expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
whole organism guca1b expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
whole organism hmgcra expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
whole organism cyp51 expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
whole organism guca1d expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
whole organism fads2 expression decreased amount, abnormal WT + MO2-nr1h3 standard conditions Fig. S2 from Pinto et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.