Morpholino

MO1-slc26a2

ID
ZDB-MRPHLNO-151215-2
Name
MO1-slc26a2
Previous Names
None
Target
Sequence
5' - TTGGTTGCAGGTGTTGATGGGTCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc26a2
No data available
Phenotype
Phenotype resulting from MO1-slc26a2
Phenotype Fish Figures
anterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 Fig. 6 with image from Liu et al., 2015
auditory receptor cell stereocilium decreased amount, abnormal AB + MO1-slc26a2 Fig. 5 with image from Liu et al., 2015
lateral line neuromast decreased amount, abnormal s356tTg + MO1-slc26a2 Fig. 5 with image from Liu et al., 2015
lateral line neuromast hair cell decreased amount, abnormal s356tTg + MO1-slc26a2 Fig. 5 with image from Liu et al., 2015
Mauthner neuron excitatory postsynaptic potential amplitude, abnormal AB + MO1-slc26a2 Fig. 8 with image from Liu et al., 2015
neuromast hair cell decreased amount, abnormal s356tTg + MO1-slc26a2 Fig. 7 with image from Liu et al., 2015
neuromast hair cell disorganized, abnormal s356tTg + MO1-slc26a2 Fig. 5 with image from Liu et al., 2015
otolith amount, abnormal AB + MO1-slc26a2 Fig. 3 with image from Liu et al., 2015
otolith decreased size, abnormal AB + MO1-slc26a2 Fig. 3 with image from Liu et al., 2015
otolith fused with otolith, abnormal AB + MO1-slc26a2 Fig. 3 with image from Liu et al., 2015
otolith mislocalised, abnormal AB + MO1-slc26a2 Fig. 3 with image from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 Fig. 6 with image from Liu et al., 2015
semicircular canal malformed, abnormal AB + MO1-slc26a2 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2015
sensory perception of sound disrupted, abnormal AB + MO1-slc26a2 Fig. 8 with image from Liu et al., 2015
startle response disrupted, abnormal AB + MO1-slc26a2 Fig. 8 with image from Liu et al., 2015
swimming behavior process quality, abnormal AB + MO1-slc26a2 Fig. 8 with image from Liu et al., 2015
Phenotype of all Fish created by or utilizing MO1-slc26a2
Phenotype Fish Conditions Figures
Mauthner neuron excitatory postsynaptic potential amplitude, abnormal AB + MO1-slc26a2 standard conditions Fig. 8 with image from Liu et al., 2015
auditory receptor cell stereocilium decreased amount, abnormal AB + MO1-slc26a2 standard conditions Fig. 5 with image from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 standard conditions Fig. 6 with image from Liu et al., 2015
anterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 standard conditions Fig. 6 with image from Liu et al., 2015
otolith fused with otolith, abnormal AB + MO1-slc26a2 standard conditions Fig. 3 with image from Liu et al., 2015
otolith mislocalised, abnormal AB + MO1-slc26a2 standard conditions Fig. 3 with image from Liu et al., 2015
startle response disrupted, abnormal AB + MO1-slc26a2 standard conditions Fig. 8 with image from Liu et al., 2015
semicircular canal malformed, abnormal AB + MO1-slc26a2 standard conditions Fig. 3 with image,  Fig. 5 with image from Liu et al., 2015
otolith amount, abnormal AB + MO1-slc26a2 standard conditions Fig. 3 with image from Liu et al., 2015
swimming behavior process quality, abnormal AB + MO1-slc26a2 standard conditions Fig. 8 with image from Liu et al., 2015
sensory perception of sound disrupted, abnormal AB + MO1-slc26a2 standard conditions Fig. 8 with image from Liu et al., 2015
otolith decreased size, abnormal AB + MO1-slc26a2 standard conditions Fig. 3 with image from Liu et al., 2015
anterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
posterior lateral line neuromast hair cell apoptotic, abnormal AB + MO1-slc26a2 + MO4-tp53 standard conditions Fig. 6 with image from Liu et al., 2015
neuromast hair cell disorganized, abnormal s356tTg + MO1-slc26a2 standard conditions Fig. 5 with image from Liu et al., 2015
neuromast hair cell decreased amount, abnormal s356tTg + MO1-slc26a2 standard conditions Fig. 7 with image from Liu et al., 2015
lateral line neuromast decreased amount, abnormal s356tTg + MO1-slc26a2 standard conditions Fig. 5 with image from Liu et al., 2015
lateral line neuromast hair cell decreased amount, abnormal s356tTg + MO1-slc26a2 standard conditions Fig. 5 with image from Liu et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.