Morpholino

MO1-dtwd2

ID

ZDB-MRPHLNO-151110-4

Name

MO1-dtwd2

Previous Names

None

Target

dtwd2 (1)

Sequence

5' - ACTATACACACACACTGACCTCAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 21

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dtwd2

No data available

Phenotype

Phenotype resulting from MO1-dtwd2

Phenotype	Fish	Figures
head morphology, abnormal	WT + MO1-dtwd2	Fig. S7 from Fitzgerald et al., 2015
somite morphology, abnormal	WT + MO1-dtwd2	Fig. S7 from Fitzgerald et al., 2015
trunk bent, abnormal	WT + MO1-dtwd2	Fig. S7 from Fitzgerald et al., 2015
whole organism apoptotic, abnormal	WT + MO1-dtwd2	Fig. S7 from Fitzgerald et al., 2015
whole organism anatomical axis decreased length, abnormal	WT + MO1-dtwd2	Fig. S7 from Fitzgerald et al., 2015

1 - 5 of 5

Phenotype of all Fish created by or utilizing MO1-dtwd2

Phenotype	Fish	Conditions	Figures
head morphology, abnormal	WT + MO1-dtwd2	standard conditions	Fig. S7 from Fitzgerald et al., 2015
somite morphology, abnormal	WT + MO1-dtwd2	standard conditions	Fig. S7 from Fitzgerald et al., 2015
trunk bent, abnormal	WT + MO1-dtwd2	standard conditions	Fig. S7 from Fitzgerald et al., 2015
whole organism anatomical axis decreased length, abnormal	WT + MO1-dtwd2	standard conditions	Fig. S7 from Fitzgerald et al., 2015
whole organism apoptotic, abnormal	WT + MO1-dtwd2	standard conditions	Fig. S7 from Fitzgerald et al., 2015

1 - 5 of 5

Citations

Include unpublished citations

Fitzgerald, T.W., Gerety, S.S., Jones, W.D., van Kogelenberg, M., King, D.A., McRae, J., Morley, K.I., Parthiban, V., Al-Turki, S., Ambridge, K., Barrett, D.M., Bayzetinova, T., Clayton, S., Coomber, E.L., Gribble, S., Jones, P., Krishnappa, N., Mason, L.E., Middleton, A., Miller, R., Prigmore, E., Rajan, D., Sifrim, A., Tivey, A.R., Ahmed, M., Akawi, N., Andrews, R., Anjum, U., Archer, H., Armstrong, R., Balasubramanian, M., Banerjee, R., Baralle, D., Batstone, P., Baty, D., Bennett, C., Berg, J., Bernhard, B., Bevan, A.P., Blair, E., Blyth, M., Bohanna, D., Bourdon, L., Bourn, D., Brady, A., Bragin, E., Brewer, C., Brueton, L., Brunstrom, K., Bumpstead, S.J., Bunyan, D.J., Burn, J., Burton, J., Canham, N., Castle, B., Chandler, K., Clasper, S., Clayton-Smith, J., Cole, T., Collins, A., Collinson, M.N., Connell, F., Cooper, N., Cox, H., Cresswell, L., Cross, G., Crow, Y., D'Alessandro, M., Dabir, T., Davidson, R., Davies, S., Dean, J., Deshpande, C., Devlin, G., Dixit, A., Dominiczak, A., Donnelly, C., Donnelly, D., Douglas, A., Duncan, A., Eason, J., Edkins, S., Ellard, S., Ellis, P., Elmslie, F., Evans, K., Everest, S., Fendick, T., Fisher, R., Flinter, F., Foulds, N., Fryer, A., Fu, B., Gardiner, C., Gaunt, L., Ghali, N., Gibbons, R., Gomes Pereira, S.L., Goodship, J., Goudie, D., Gray, E., Greene, P., Greenhalgh, L., Harrison, L., Hawkins, R., Hellens, S., Henderson, A., Hobson, E., Holden, S., Holder, S., Hollingsworth, G., Homfray, T., Humphreys, M., Hurst, J., Ingram, S., Irving, M., Jarvis, J., Jenkins, L., Johnson, D., Jones, D., Jones, E., Josifova, D., Joss, S., Kaemba, B., Kazembe, S., Kerr, B., Kini, U., Kinning, E., Kirby, G., Kirk, C., Kivuva, E., Kraus, A., Kumar, D., Lachlan, K., Lam, W., Lampe, A., Langman, C., Lees, M., Lim, D., Lowther, G., Lynch, S.A., Magee, A., Maher, E., Mansour, S., Marks, K., Martin, K., Maye, U., McCann, E., McConnell, V., McEntagart, M., McGowan, R., McKay, K., McKee, S., McMullan, D.J., McNerlan, S., Mehta, S., Metcalfe, K., Miles, E., Mohammed, S., Montgomery, T., Moore, D., Morgan, S., Morris, A., Morton, J., Mugalaasi, H., Murday, V., Nevitt, L., Newbury-Ecob, R., Norman, A., O'Shea, R., Ogilvie, C., Park, S., Parker, M.J., Patel, C., Paterson, J., Payne, S., Phipps, J., Pilz, D.T., Porteous, D., Pratt, N., Prescott, K., Price, S., Pridham, A., Procter, A., Purnell, H., Ragge, N., Rankin, J., Raymond, L., Rice, D., Robert, L., Roberts, E., Roberts, G., Roberts, J., Roberts, P., Ross, A., Rosser, E., Saggar, A., Samant, S., Sandford, R., Sarkar, A., Schweiger, S., Scott, C., Scott, R., Selby, A., Seller, A., Sequeira, C., Shannon, N., Sharif, S., Shaw-Smith, C., Shearing, E., Shears, D., Simonic, I., Simpkin, D., Singzon, R., Skitt, Z., Smith, A., Smith, B., Smith, K., Smithson, S., Sneddon, L., Splitt, M., Squires, M., Stewart, F., Stewart, H., Suri, M., Sutton, V., Swaminathan, G.J., Sweeney, E., Tatton-Brown, K., Taylor, C., Taylor, R., Tein, M., Temple, I.K., Thomson, J., Tolmie, J., Torokwa, A (2015) Large-scale discovery of novel genetic causes of developmental disorders. Nature. 519(7542):223-228

1 - 1 of 1

Show