Morpholino

MO2-setd7

ID

ZDB-MRPHLNO-151013-6

Name

MO2-setd7

Previous Names

None

Target

Sequence

5' - AGCTTCTCGTACCTTCCACCACTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-setd7

Phenotype

Phenotype resulting from MO2-setd7

Phenotype	Fish	Figures
heart hypoplastic, abnormal	twu34Tg + MO2-setd7	Fig. 6 from Kim et al., 2015
heart linear, abnormal	twu34Tg + MO2-setd7	Fig. 6 from Kim et al., 2015
heart morphology, abnormal	twu34Tg + MO2-setd7	Fig. 6 from Kim et al., 2015
heart looping disrupted, abnormal	twu34Tg + MO2-setd7	Fig. 6 from Kim et al., 2015
heart morphogenesis disrupted, abnormal	twu34Tg + MO2-setd7	Fig. 6 from Kim et al., 2015
pericardium edematous, abnormal	AB + MO2-setd7	Fig. 4 from Kim et al., 2015

Phenotype of all Fish created by or utilizing MO2-setd7

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	AB + MO2-setd7	standard conditions	Fig. 4 from Kim et al., 2015
heart linear, abnormal	twu34Tg + MO2-setd7	standard conditions	Fig. 6 from Kim et al., 2015
heart hypoplastic, abnormal	twu34Tg + MO2-setd7	standard conditions	Fig. 6 from Kim et al., 2015
heart looping disrupted, abnormal	twu34Tg + MO2-setd7	standard conditions	Fig. 6 from Kim et al., 2015
heart morphogenesis disrupted, abnormal	twu34Tg + MO2-setd7	standard conditions	Fig. 6 from Kim et al., 2015
heart morphology, abnormal	twu34Tg + MO2-setd7	standard conditions	Fig. 6 from Kim et al., 2015
whole organism curved, abnormal	AB + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 5 from Kim et al., 2015
whole organism monstrous, abnormal	AB + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 5 from Kim et al., 2015
whole organism decreased length, abnormal	AB + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 5 from Kim et al., 2015
heart linear, abnormal	twu34Tg + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 6 from Kim et al., 2015
heart hypoplastic, abnormal	twu34Tg + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 6 from Kim et al., 2015
heart looping disrupted, abnormal	twu34Tg + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 6 from Kim et al., 2015
heart morphology, abnormal	twu34Tg + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 6 from Kim et al., 2015
heart morphogenesis disrupted, abnormal	twu34Tg + MO2-setd7 + MO4-smyd3	standard conditions	Fig. 6 from Kim et al., 2015

Citations