Morpholino

MO3-kmt2d

ID

ZDB-MRPHLNO-150930-5

Name

MO3-kmt2d

Previous Names

SS1 (1)

Target

kmt2d (1)

Sequence

5' - GGTATAGCAGCAATGACAAACCATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-kmt2d

No data available

Phenotype

Phenotype resulting from MO3-kmt2d

No data available

Phenotype of all Fish created by or utilizing MO3-kmt2d

Phenotype	Fish	Conditions	Figures
hypothalamus decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
midbrain neuron differentiation decreased process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 5 from Van Laarhoven et al., 2015
optic tectum decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
midbrain nucleus elongated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
embryonic viscerocranium morphogenesis decreased process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
tegmentum decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
head lacks all parts of type Meckel's cartilage, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
head lacks all parts of type ceratohyal cartilage, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
medulla oblongata decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. S4 from Van Laarhoven et al., 2015
forebrain nucleus elongated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
neurocranial trabecula truncated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
brain development process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
head lacks all parts of type opercle, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
pericardium edematous, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. S3 from Van Laarhoven et al., 2015
brain decreased size, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
head lacks all parts of type cleithrum, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
ethmoid cartilage truncated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
hindbrain decreased size, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. S4 from Van Laarhoven et al., 2015
head lacks all parts of type pharyngeal arch 3-7, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
forebrain neuron differentiation decreased process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 5 from Van Laarhoven et al., 2015

Citations