Morpholino

MO2-kmt2d

ID

ZDB-MRPHLNO-150930-3

Name

MO2-kmt2d

Previous Names

None

Target

kmt2d (1)

Sequence

5' - CGCAGTTTGATTTCTGCTCGTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-kmt2d

No data available

Phenotype

Phenotype resulting from MO2-kmt2d

No data available

Phenotype of all Fish created by or utilizing MO2-kmt2d

Phenotype	Fish	Conditions	Figures
hypothalamus decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
midbrain neuron differentiation decreased process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 5 from Van Laarhoven et al., 2015
optic tectum decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
midbrain nucleus elongated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
embryonic viscerocranium morphogenesis decreased process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
tegmentum decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
head lacks all parts of type Meckel's cartilage, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
head lacks all parts of type ceratohyal cartilage, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
medulla oblongata decreased thickness, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. S4 from Van Laarhoven et al., 2015
forebrain nucleus elongated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
neurocranial trabecula truncated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
brain development process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
head lacks all parts of type opercle, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
pericardium edematous, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. S3 from Van Laarhoven et al., 2015
brain decreased size, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 4 from Van Laarhoven et al., 2015
head lacks all parts of type cleithrum, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
ethmoid cartilage truncated, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
hindbrain decreased size, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. S4 from Van Laarhoven et al., 2015
head lacks all parts of type pharyngeal arch 3-7, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 2 from Van Laarhoven et al., 2015
forebrain neuron differentiation decreased process quality, abnormal	AB/TL + MO2-kmt2d + MO3-kmt2d	standard conditions	Fig. 5 from Van Laarhoven et al., 2015
heart development disrupted, abnormal	co10Tg + MO2-kmt2d + MO4-kmt2d	standard conditions	Fig. 3 from Van Laarhoven et al., 2015
cardiac ventricle orientation atrium, abnormal	co10Tg + MO2-kmt2d + MO4-kmt2d	standard conditions	Fig. 3 from Van Laarhoven et al., 2015
heart looping process quality, abnormal	co10Tg + MO2-kmt2d + MO4-kmt2d	standard conditions	Fig. 3 from Van Laarhoven et al., 2015

Citations