Morpholino

MO2-iqsec1b

ID
ZDB-MRPHLNO-150901-5
Name
MO2-iqsec1b
Previous Names
None
Target
Sequence
5' - GCTGACTGAATGGAGAAACAATAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-iqsec1b
No data available
Phenotype
Phenotype resulting from MO2-iqsec1b
Phenotype of all Fish created by or utilizing MO2-iqsec1b
Phenotype Fish Conditions Figures
vascular lymphangioblast absent, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6Fig. S6 from Manavski et al., 2014
intersegmental vessel structure, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel structure, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel incomplete structure, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast absent, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
brain hydrocephalic, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S5 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
post-vent vasculature edematous, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. S5 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel incomplete structure, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
common cardinal vein malformed, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO1-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast absent, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
brain hydrocephalic, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
vasculature development disrupted, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
dorsal longitudinal anastomotic vessel incomplete structure, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
common cardinal vein malformed, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
intersegmental vessel malformed, abnormal y1Tg + MO2-iqsec1a + MO2-iqsec1b + MO4-tp53 standard conditions Fig. 6 from Manavski et al., 2014
Citations