Morpholino

MO1-sod2

ID

ZDB-MRPHLNO-150428-3

Name

MO1-sod2

Previous Names

None

Target

Sequence

5' - GAACATATCCGACTCTGCACAGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-sod2

Expressed Gene	Anatomy	Figures
sod3b	whole organism	Fig. 6 from Eason et al., 2017

Phenotype

Phenotype resulting from MO1-sod2

Phenotype	Fish	Figures
blood island macrophage decreased amount, abnormal	AB + MO1-sod2	Fig. 4 from Peterman et al., 2015
blood island neutrophil decreased amount, abnormal	i114Tg + MO1-sod2	Fig. 4 from Peterman et al., 2015
head macrophage decreased amount, abnormal	AB + MO1-sod2	Fig. 4 from Peterman et al., 2015
heart macrophage decreased amount, abnormal	AB + MO1-sod2	Fig. 4 from Peterman et al., 2015
respiratory burst involved in defense response decreased process quality, abnormal	AB + MO1-sod2	Fig. 4 from Peterman et al., 2015
whole organism sod3b expression decreased amount, abnormal	WT + MO1-sod2	Fig. 6 from Eason et al., 2017

Phenotype of all Fish created by or utilizing MO1-sod2

Phenotype	Fish	Conditions	Figures
respiratory burst involved in defense response decreased process quality, abnormal	AB + MO1-sod2	standard conditions	Fig. 4 from Peterman et al., 2015
heart macrophage decreased amount, abnormal	AB + MO1-sod2	standard conditions	Fig. 4 from Peterman et al., 2015
head macrophage decreased amount, abnormal	AB + MO1-sod2	standard conditions	Fig. 4 from Peterman et al., 2015
defense response to bacterium disrupted, abnormal	AB + MO1-sod2	bacterial treatment: Pseudomonas aeruginosa	Fig. 3 from Peterman et al., 2015
whole organism decreased life span, abnormal	AB + MO1-sod2	bacterial treatment: Pseudomonas aeruginosa	Fig. 3 from Peterman et al., 2015
blood island macrophage decreased amount, abnormal	AB + MO1-sod2	standard conditions	Fig. 4 from Peterman et al., 2015
whole organism dead, abnormal	AB + MO1-sod2	bacterial treatment: Pseudomonas aeruginosa	Fig. 3 from Peterman et al., 2015
whole organism sod3b expression decreased amount, abnormal	WT + MO1-sod2	standard conditions	Fig. 6 from Eason et al., 2017
whole organism sod3b expression decreased amount, abnormal	WT + MO1-sod2	chemical treatment by environment: ethanol	Fig. 6 from Eason et al., 2017
blood island neutrophil decreased amount, abnormal	i114Tg + MO1-sod2	standard conditions	Fig. 4 from Peterman et al., 2015
anterior segment eye neural crest cell migration decreased occurrence, abnormal	zf15Tg + MO1-sod2	chemical treatment by environment: ethanol	Fig. 7 from Eason et al., 2017

Citations