Morpholino
MO2-klf2b
- ID
- ZDB-MRPHLNO-150427-1
- Name
- MO2-klf2b
- Previous Names
- None
- Target
- Sequence
-
5' - AAAGGCAAGGTAAAGCCATGTCCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klf2b
No data available
Phenotype
Phenotype resulting from MO2-klf2b
No data available
Phenotype of all Fish created by or utilizing MO2-klf2b
1 - 4 of 4
Citations
- Paolini, A., Sharipova, D., Lange, T., Abdelilah-Seyfried, S. (2023) Wnt9 directs zebrafish heart tube assembly via a combination of canonical and non-canonical pathway signaling. Development (Cambridge, England). 150(18):
- Li, W., Tran, V., Shaked, I., Xue, B., Moore, T., Lightle, R., Kleinfeld, D., Awad, I.A., Ginsberg, M.H. (2021) Abortive intussusceptive angiogenesis causes multi-cavernous vascular malformations. eLIFE. 10:
- Donat, S., Lourenço, M., Paolini, A., Otten, C., Renz, M., Abdelilah-Seyfried, S. (2018) Heg1 and Ccm1/2 proteins control endocardial mechanosensitivity during zebrafish valvulogenesis. eLIFE. 7:e28939
- Renz, M., Otten, C., Faurobert, E., Rudolph, F., Zhu, Y., Boulday, G., Duchene, J., Mickoleit, M., Dietrich, A.C., Ramspacher, C., Steed, E., Manet-Dupé, S., Benz, A., Hassel, D., Vermot, J., Huisken, J., Tournier-Lasserve, E., Felbor, U., Sure, U., Albiges-Rizo, C., Abdelilah-Seyfried, S. (2015) Regulation of β1 Integrin-Klf2-Mediated Angiogenesis by CCM Proteins. Developmental Cell. 32:181-190
1 - 4 of 4
Show