Morpholino

MO1-zbtb42

ID
ZDB-MRPHLNO-150323-10
Name
MO1-zbtb42
Previous Names
None
Target
Sequence
5' - AACTCCATTCTTATGGACGAAAACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zbtb42
No data available
Phenotype
Phenotype resulting from MO1-zbtb42
Phenotype Fish Figures
caudal fin bent, abnormal WT + MO1-zbtb42 Fig. 2 from Patel et al., 2014
eye decreased size, abnormal WT + MO1-zbtb42 Fig. 2 from Patel et al., 2014
head decreased size, abnormal WT + MO1-zbtb42 Fig. 2 from Patel et al., 2014
heart edematous, abnormal WT + MO1-zbtb42 Fig. 2,  Fig. 5 from Patel et al., 2014
heart contraction process quality, abnormal WT + MO1-zbtb42 Fig. 2,  Fig. 5 from Patel et al., 2014
muscle decreased functionality, abnormal WT + MO1-zbtb42 text only from Patel et al., 2014
muscle decreased strength, abnormal WT + MO1-zbtb42 text only from Patel et al., 2014
skeletal muscle disorganized, abnormal WT + MO1-zbtb42 Fig. 2,  Fig. 3 from Patel et al., 2014
skeletal muscle neuromuscular junction broken, abnormal WT + MO1-zbtb42 Fig. 3 from Patel et al., 2014
skeletal muscle neuromuscular junction decreased amount, abnormal WT + MO1-zbtb42 Fig. 3 from Patel et al., 2014
skeletal muscle neuromuscular junction decreased size, abnormal WT + MO1-zbtb42 Fig. 3 from Patel et al., 2014
skeletal muscle cell atrophied, abnormal WT + MO1-zbtb42 Fig. 3 from Patel et al., 2014
skeletal muscle cell decreased width, abnormal WT + MO1-zbtb42 Fig. 3 from Patel et al., 2014
skeletal muscle cell disorganized, abnormal WT + MO1-zbtb42 Fig. 3,  Fig. 5 from Patel et al., 2014
skeletal muscle cell misaligned with skeletal muscle cell, abnormal WT + MO1-zbtb42 Fig. 3 from Patel et al., 2014
skeletal muscle cell H zone absent, abnormal WT + MO1-zbtb42 Fig. 4 from Patel et al., 2014
skeletal muscle cell sarcomere disorganized, abnormal WT + MO1-zbtb42 Fig. 3,  Fig. 4 from Patel et al., 2014
skeletal muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-zbtb42 Fig. 3,  Fig. 4 from Patel et al., 2014
skeletal muscle cell skeletal muscle myofibril disoriented, abnormal WT + MO1-zbtb42 Fig. 4 from Patel et al., 2014
thigmotaxis decreased process quality, abnormal WT + MO1-zbtb42 text only from Patel et al., 2014
whole organism decreased length, abnormal WT + MO1-zbtb42 Fig. 2 from Patel et al., 2014
whole organism decreased mobility, abnormal WT + MO1-zbtb42 text only from Patel et al., 2014
Phenotype of all Fish created by or utilizing MO1-zbtb42
Phenotype Fish Conditions Figures
skeletal muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-zbtb42 standard conditions Fig. 3,  Fig. 4 from Patel et al., 2014
skeletal muscle neuromuscular junction decreased size, abnormal WT + MO1-zbtb42 standard conditions Fig. 3 from Patel et al., 2014
skeletal muscle neuromuscular junction decreased amount, abnormal WT + MO1-zbtb42 standard conditions Fig. 3 from Patel et al., 2014
head decreased size, abnormal WT + MO1-zbtb42 standard conditions Fig. 2 from Patel et al., 2014
skeletal muscle cell decreased width, abnormal WT + MO1-zbtb42 standard conditions Fig. 3 from Patel et al., 2014
muscle decreased functionality, abnormal WT + MO1-zbtb42 standard conditions text only from Patel et al., 2014
heart contraction process quality, abnormal WT + MO1-zbtb42 standard conditions Fig. 2,  Fig. 5 from Patel et al., 2014
heart edematous, abnormal WT + MO1-zbtb42 standard conditions Fig. 2,  Fig. 5 from Patel et al., 2014
skeletal muscle cell skeletal muscle myofibril disoriented, abnormal WT + MO1-zbtb42 standard conditions Fig. 4 from Patel et al., 2014
skeletal muscle cell misaligned with skeletal muscle cell, abnormal WT + MO1-zbtb42 standard conditions Fig. 3 from Patel et al., 2014
muscle decreased strength, abnormal WT + MO1-zbtb42 standard conditions text only from Patel et al., 2014
whole organism decreased length, abnormal WT + MO1-zbtb42 standard conditions Fig. 2 from Patel et al., 2014
skeletal muscle cell H zone absent, abnormal WT + MO1-zbtb42 standard conditions Fig. 4 from Patel et al., 2014
skeletal muscle disorganized, abnormal WT + MO1-zbtb42 standard conditions Fig. 2,  Fig. 3 from Patel et al., 2014
eye decreased size, abnormal WT + MO1-zbtb42 standard conditions Fig. 2 from Patel et al., 2014
whole organism decreased mobility, abnormal WT + MO1-zbtb42 standard conditions text only from Patel et al., 2014
skeletal muscle cell sarcomere disorganized, abnormal WT + MO1-zbtb42 standard conditions Fig. 3,  Fig. 4 from Patel et al., 2014
skeletal muscle cell disorganized, abnormal WT + MO1-zbtb42 standard conditions Fig. 3,  Fig. 5 from Patel et al., 2014
thigmotaxis decreased process quality, abnormal WT + MO1-zbtb42 standard conditions text only from Patel et al., 2014
skeletal muscle cell atrophied, abnormal WT + MO1-zbtb42 standard conditions Fig. 3 from Patel et al., 2014
caudal fin bent, abnormal WT + MO1-zbtb42 standard conditions Fig. 2 from Patel et al., 2014
skeletal muscle neuromuscular junction broken, abnormal WT + MO1-zbtb42 standard conditions Fig. 3 from Patel et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.