Morpholino
MO1-ldlra
- ID
- ZDB-MRPHLNO-150312-1
- Name
- MO1-ldlra
- Previous Names
- None
- Target
- Sequence
-
5' - AGATCACATTTCATTTCTTACAGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ldlra
Expressed Gene | Anatomy | Figures |
---|---|---|
abca1b |
Fig. S6
from O'Hare et al., 2014 |
|
hmgcra |
Fig. S6
from O'Hare et al., 2014 |
|
ldlra |
Fig. 1
from O'Hare et al., 2014 |
|
pcsk9 |
|
Fig. S6
from O'Hare et al., 2014 |
srebf2 |
Fig. S6
from O'Hare et al., 2014 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-ldlra
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-ldlra
1 - 5 of 20 Show all
Citations
- Montasser, M.E., O'Hare, E.A., Wang, X., Howard, A.D., McFarland, R., Perry, J.A., Ryan, K.A., Rice, K., Jaquish, C.E., Shuldiner, A.R., Miller, M., Mitchell, B.D., Zaghloul, N.A., Chang, Y.C. (2018) An APOO Pseudogene on Chromosome 5q is Associated with LDL-C Levels. Circulation. 138(13):1343-1355
- O'Hare, E.A., Wang, X., Montasser, M.E., Chang, Y.P., Mitchell, B.D., Zaghloul, N.A. (2014) Disruption of ldlr causes increased LDL-cholesterol and vascular lipid accumulation in a zebrafish model of hypercholesterolemia. Journal of Lipid Research. 55(11):2242-53
1 - 2 of 2
Show