Morpholino

MO9-rtn4a

ID

ZDB-MRPHLNO-140923-1

Name

MO9-rtn4a

Previous Names

None

Target

rtn4a (1)

Sequence

5' - TAAAGTAACTTCAAGATGCGCCGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO. Targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO9-rtn4a

No data available

Phenotype

Phenotype resulting from MO9-rtn4a

Phenotype	Fish	Figures
brain decreased size, abnormal	WT + MO9-rtn4a	Fig. 7 from Pinzón-Olejua et al., 2014
cranial nerve II has fewer parts of type retinal ganglion cell axon, abnormal	s356tTg + MO9-rtn4a	Fig. 6 from Pinzón-Olejua et al., 2014
forebrain decreased size, abnormal	WT + MO9-rtn4a	Fig. 7 from Pinzón-Olejua et al., 2014
head altered number of neuromast, abnormal	s356tTg + MO9-rtn4a	Fig. 7 from Pinzón-Olejua et al., 2014
neuromast displaced, abnormal	s356tTg + MO9-rtn4a	Fig. 7 from Pinzón-Olejua et al., 2014
optic tectum decreased size, abnormal	WT + MO9-rtn4a	Fig. 7 from Pinzón-Olejua et al., 2014
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal	s356tTg + MO9-rtn4a	Fig. 7 from Pinzón-Olejua et al., 2014
retina has fewer parts of type retinal ganglion cell, abnormal	s356tTg + MO9-rtn4a	Fig. 6 from Pinzón-Olejua et al., 2014
retinal ganglion cell axon guidance process quality, abnormal	s356tTg + MO9-rtn4a	Fig. 6 from Pinzón-Olejua et al., 2014

Phenotype of all Fish created by or utilizing MO9-rtn4a

Phenotype	Fish	Conditions	Figures
optic tectum decreased size, abnormal	WT + MO9-rtn4a	standard conditions	Fig. 7 from Pinzón-Olejua et al., 2014
brain decreased size, abnormal	WT + MO9-rtn4a	standard conditions	Fig. 7 from Pinzón-Olejua et al., 2014
retinal ganglion cell axon guidance process quality, abnormal	WT + MO9-rtn4a	standard conditions	Fig. 6 from Pinzón-Olejua et al., 2014
cranial nerve II has fewer parts of type retinal ganglion cell axon, abnormal	WT + MO9-rtn4a	standard conditions	Fig. 6 from Pinzón-Olejua et al., 2014
retina has fewer parts of type retinal ganglion cell, abnormal	WT + MO9-rtn4a	standard conditions	Fig. 6 from Pinzón-Olejua et al., 2014
forebrain decreased size, abnormal	WT + MO9-rtn4a	standard conditions	Fig. 7 from Pinzón-Olejua et al., 2014
eye decreased size, abnormal	WT + MO11-rtn4a + MO14-rtn4a + MO9-rtn4a	standard conditions	Fig. 4 from Pinzón-Olejua et al., 2014
forebrain decreased size, abnormal	WT + MO11-rtn4a + MO14-rtn4a + MO9-rtn4a	standard conditions	Fig. 4 from Pinzón-Olejua et al., 2014
immature eye decreased size, abnormal	WT + MO11-rtn4a + MO14-rtn4a + MO9-rtn4a	standard conditions	Fig. 4 from Pinzón-Olejua et al., 2014
head decreased size, abnormal	WT + MO11-rtn4a + MO14-rtn4a + MO9-rtn4a	standard conditions	Fig. 4 from Pinzón-Olejua et al., 2014
brain decreased size, abnormal	WT + MO11-rtn4a + MO14-rtn4a + MO9-rtn4a	standard conditions	Fig. 4 from Pinzón-Olejua et al., 2014
forebrain flattened, abnormal	WT + MO11-rtn4a + MO14-rtn4a + MO9-rtn4a	standard conditions	Fig. 4 from Pinzón-Olejua et al., 2014
neuromast displaced, abnormal	s356tTg + MO9-rtn4a	standard conditions	Fig. 7 from Pinzón-Olejua et al., 2014
retina has fewer parts of type retinal ganglion cell, abnormal	s356tTg + MO9-rtn4a	standard conditions	Fig. 6 from Pinzón-Olejua et al., 2014
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal	s356tTg + MO9-rtn4a	standard conditions	Fig. 7 from Pinzón-Olejua et al., 2014
head altered number of neuromast, abnormal	s356tTg + MO9-rtn4a	standard conditions	Fig. 7 from Pinzón-Olejua et al., 2014
cranial nerve II has fewer parts of type retinal ganglion cell axon, abnormal	s356tTg + MO9-rtn4a	standard conditions	Fig. 6 from Pinzón-Olejua et al., 2014
retinal ganglion cell axon guidance process quality, abnormal	s356tTg + MO9-rtn4a	standard conditions	Fig. 6 from Pinzón-Olejua et al., 2014

Citations