Morpholino
MO1-mpped2
- ID
- ZDB-MRPHLNO-140811-5
- Name
- MO1-mpped2
- Previous Names
- None
- Target
- Sequence
-
5' - GGCATGAGCAGGTCACAGAGGAACA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The author was contacted and provided the sequence of this morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mpped2
Expressed Gene | Anatomy | Figures |
---|---|---|
nphs1 |
Fig. 2
from Pattaro et al., 2012 |
|
pax2a |
Fig. 2
from Pattaro et al., 2012 |
|
slc12a3 |
Fig. 2
from Pattaro et al., 2012 |
|
slc20a1a |
Fig. 2
from Pattaro et al., 2012 |
Phenotype
Phenotype resulting from MO1-mpped2
Phenotype | Fish | Figures |
---|---|---|
heart edematous, abnormal | WT + MO1-mpped2 |
Fig. S9
from Pattaro et al., 2012 |
kidney development process quality, abnormal | WT + MO1-mpped2 |
Fig. 2
from Pattaro et al., 2012 |
Phenotype of all Fish created by or utilizing MO1-mpped2
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
kidney development process quality, abnormal | WT + MO1-mpped2 | standard conditions |
Fig. 2
from Pattaro et al., 2012 |
heart edematous, abnormal | WT + MO1-mpped2 | standard conditions |
Fig. S9
from Pattaro et al., 2012 |
Citations