Morpholino

MO1-fto

ID
ZDB-MRPHLNO-140806-1
Name
MO1-fto
Previous Names
None
Target
Sequence
5' - GTTTACGCTGCCTCGGTTTCATAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fto
Expressed Gene Anatomy Figures
ctnnb1 Fig. 2 with image from Osborn et al., 2014
lef1 Fig. 2 with image from Osborn et al., 2014
Phenotype
Phenotype resulting from MO1-fto
Phenotype Fish Figures
canonical Wnt signaling pathway disrupted, abnormal AB/TL + MO1-fto Fig. 2 with image from Osborn et al., 2014
cranial cartilage decreased size, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
eye decreased distance eye, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
eye decreased size, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
head decreased size, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
Kupffer's vesicle decreased functionality, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
Kupffer's vesicle cilium decreased length, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
left/right pattern formation disrupted, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
melanocyte mislocalised, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
neural crest cell migration disrupted, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
neural tube cilium disorganized, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
olfactory pit cilium decreased amount, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
pharyngeal arch decreased width, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
pronephric duct cilium disorganized, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
pronephric tubule dilated, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
renal filtration disrupted, abnormal AB/TL + MO1-fto Fig. 5 with image from Osborn et al., 2014
retina layer formation disrupted, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
somite decreased size, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
whole organism anterior-posterior axis curved, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
whole organism dorsal-ventral axis shortened, abnormal AB/TL + MO1-fto Fig. 1 with image from Osborn et al., 2014
Phenotype of all Fish created by or utilizing MO1-fto
Phenotype Fish Conditions Figures
pharyngeal arch decreased width, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
eye decreased size, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
melanocyte mislocalised, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
somite decreased size, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
cranial cartilage decreased size, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
neural crest cell migration disrupted, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
retina layer formation disrupted, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
pronephric duct cilium disorganized, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
head decreased size, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
left/right pattern formation disrupted, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
canonical Wnt signaling pathway disrupted, abnormal AB/TL + MO1-fto standard conditions Fig. 2 with image from Osborn et al., 2014
renal filtration disrupted, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
whole organism anterior-posterior axis curved, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
pronephric tubule dilated, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
olfactory pit cilium decreased amount, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
eye decreased distance eye, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
neural tube cilium disorganized, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
whole organism dorsal-ventral axis shortened, abnormal AB/TL + MO1-fto standard conditions Fig. 1 with image from Osborn et al., 2014
Kupffer's vesicle cilium decreased length, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
Kupffer's vesicle decreased functionality, abnormal AB/TL + MO1-fto standard conditions Fig. 5 with image from Osborn et al., 2014
cranial cartilage decreased size, abnormal AB/TL + MO1-fto + MO4-tp53 standard conditions Fig. 1 with image from Osborn et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.