Morpholino

MO1-adap2

ID
ZDB-MRPHLNO-140710-3
Name
MO1-adap2
Previous Names
None
Target
Sequence
5' - TTGTTCTTTTCCCGATTTGCCATAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adap2
Expressed Gene Anatomy Figures
bmp4 Fig. 6 from Venturin et al., 2014
myl7 Fig. 4 from Venturin et al., 2014
notch1b Fig. 6 from Venturin et al., 2014
Phenotype
Phenotype resulting from MO1-adap2
Phenotype Fish Figures
atrioventricular canal shape, abnormal s843Tg; sd2Tg + MO1-adap2 Fig. 3 from Venturin et al., 2014
atrioventricular valve morphology, abnormal AB + MO1-adap2 Fig. 5 from Venturin et al., 2014
atrioventricular valve development disrupted, abnormal AB + MO1-adap2 Fig. 5 from Venturin et al., 2014
blood accumulation head, abnormal AB + MO1-adap2 Fig. 2 from Venturin et al., 2014
blood accumulation trunk, abnormal AB + MO1-adap2 Fig. 2 from Venturin et al., 2014
blood accumulation post-vent region, abnormal AB + MO1-adap2 Fig. 2 from Venturin et al., 2014
blood circulation disrupted, abnormal AB + MO1-adap2 Fig. 2 from Venturin et al., 2014
cardiac ventricle decreased size, abnormal AB + MO1-adap2 Fig. 4,  Fig. 5,  Fig. S6 from Venturin et al., 2014
endocardial cushion morphology, abnormal AB + MO1-adap2 Fig. 5 from Venturin et al., 2014
heart morphology, abnormal AB + MO1-adap2 Fig. 3,  Fig. 4,  Fig. 5 from Venturin et al., 2014
heart development disrupted, abnormal s843Tg; sd2Tg + MO1-adap2 Fig. 3 from Venturin et al., 2014
heart jogging disrupted, abnormal AB + MO1-adap2 Fig. 4 from Venturin et al., 2014
heart looping disrupted, abnormal AB + MO1-adap2 Fig. 4 from Venturin et al., 2014
post-vent region bent, abnormal AB + MO1-adap2 Fig. 2 from Venturin et al., 2014
post-vent region increased curvature, abnormal s843Tg; sd2Tg + MO1-adap2 Fig. 2,  Fig. 3 from Venturin et al., 2014
Phenotype of all Fish created by or utilizing MO1-adap2
Phenotype Fish Conditions Figures
endocardial cushion morphology, abnormal AB + MO1-adap2 standard conditions Fig. 5 from Venturin et al., 2014
heart looping disrupted, abnormal AB + MO1-adap2 standard conditions Fig. 4 from Venturin et al., 2014
heart morphology, abnormal AB + MO1-adap2 standard conditions Fig. 4,  Fig. 5 from Venturin et al., 2014
blood accumulation trunk, abnormal AB + MO1-adap2 standard conditions Fig. 2 from Venturin et al., 2014
blood accumulation post-vent region, abnormal AB + MO1-adap2 standard conditions Fig. 2 from Venturin et al., 2014
heart jogging disrupted, abnormal AB + MO1-adap2 standard conditions Fig. 4 from Venturin et al., 2014
post-vent region increased curvature, abnormal AB + MO1-adap2 standard conditions Fig. 2 from Venturin et al., 2014
cardiac ventricle decreased size, abnormal AB + MO1-adap2 standard conditions Fig. 4,  Fig. 5,  Fig. S6 from Venturin et al., 2014
blood circulation disrupted, abnormal AB + MO1-adap2 standard conditions Fig. 2 from Venturin et al., 2014
atrioventricular valve morphology, abnormal AB + MO1-adap2 standard conditions Fig. 5 from Venturin et al., 2014
post-vent region bent, abnormal AB + MO1-adap2 standard conditions Fig. 2 from Venturin et al., 2014
blood accumulation head, abnormal AB + MO1-adap2 standard conditions Fig. 2 from Venturin et al., 2014
atrioventricular valve development disrupted, abnormal AB + MO1-adap2 standard conditions Fig. 5 from Venturin et al., 2014
heart morphology, abnormal s843Tg; sd2Tg + MO1-adap2 standard conditions Fig. 3 from Venturin et al., 2014
heart development disrupted, abnormal s843Tg; sd2Tg + MO1-adap2 standard conditions Fig. 3 from Venturin et al., 2014
post-vent region increased curvature, abnormal s843Tg; sd2Tg + MO1-adap2 standard conditions Fig. 3 from Venturin et al., 2014
atrioventricular canal shape, abnormal s843Tg; sd2Tg + MO1-adap2 standard conditions Fig. 3 from Venturin et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.