Morpholino

MO2-fhl1a

ID
ZDB-MRPHLNO-140707-3
Name
MO2-fhl1a
Previous Names
  • fhlA -MO2 (1)
Target
Sequence
5' - GACCTGAGTGCCTGTAGTAGCTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fhl1a
No data available
Phenotype
Phenotype resulting from MO2-fhl1a
Phenotype Fish Figures
pigmentation decreased process quality, abnormal WT + MO2-fhl1a Fig. 2 from Xie et al., 2013
trunk decreased length, abnormal WT + MO2-fhl1a Fig. 2 from Xie et al., 2013
whole organism curved, abnormal WT + MO2-fhl1a Fig. 2 from Xie et al., 2013
Phenotype of all Fish created by or utilizing MO2-fhl1a
Phenotype Fish Conditions Figures
whole organism pax7a expression decreased amount, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Chen et al., 2018
somite decreased size, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 1 from Chen et al., 2018
whole organism mylk2 expression decreased amount, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Chen et al., 2018
somite mef2ca expression decreased amount, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Chen et al., 2018
somite shape, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 1 from Chen et al., 2018
somite myod1 expression decreased amount, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 2,  Fig. 4 from Chen et al., 2018
somite morphology, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 1 from Chen et al., 2018
skeletal muscle ab-mf20 labeling decreased distribution, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 2 from Chen et al., 2018
skeletal muscle satellite cell decreased amount, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Chen et al., 2018
whole organism pax7b expression decreased amount, abnormal AB + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Chen et al., 2018
trunk decreased length, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 2 from Xie et al., 2013
cardiac ventricle has extra parts of type cell, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 5,  Fig. S2 from Xie et al., 2013
whole organism curved, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 2 from Xie et al., 2013
pigmentation decreased process quality, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 2 from Xie et al., 2013
cardiac ventricle increased size, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3,  Fig. 6 from Xie et al., 2013
heart contraction process quality, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 4 from Xie et al., 2013
atrium increased size, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3,  Fig. 6 from Xie et al., 2013
atrium has extra parts of type cell, abnormal WT + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 5,  Fig. S2 from Xie et al., 2013
whole organism curved, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
pigmentation decreased process quality, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
trunk decreased length, abnormal WT + MO1-fhl1a + MO2-fhl1a + MO4-tp53 standard conditions Fig. 2 from Xie et al., 2013
trunk decreased length, abnormal WT + MO2-fhl1a standard conditions Fig. 2 from Xie et al., 2013
pigmentation decreased process quality, abnormal WT + MO2-fhl1a standard conditions Fig. 2 from Xie et al., 2013
whole organism curved, abnormal WT + MO2-fhl1a standard conditions Fig. 2 from Xie et al., 2013
cardiac ventricle increased size, abnormal hsc4Tg + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Xie et al., 2013
atrium increased size, abnormal hsc4Tg + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Xie et al., 2013
atrium increased size, abnormal pku3Et + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Xie et al., 2013
cardiac ventricle increased size, abnormal pku3Et + MO1-fhl1a + MO2-fhl1a standard conditions Fig. 3 from Xie et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.