Morpholino
MO1-cxcl8b.1
- ID
- ZDB-MRPHLNO-140630-2
- Name
- MO1-cxcl8b.1
- Previous Names
-
- MO cxcl8-l2 E1/I1 (1)
- Target
- Sequence
-
5' - GCCAATGAGGGTAAGCAGATACTAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cxcl8b.1
No data available
Phenotype
Phenotype resulting from MO1-cxcl8b.1
Phenotype | Fish | Figures |
---|---|---|
intersegmental vessel morphology, abnormal | i114Tg; y1Tg + MO1-cxcl8b.1 |
Fig. S1 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-cxcl8b.1
1 - 5 of 14 Show all
Citations
- Coombs, C., Georgantzoglou, A., Walker, H.A., Patt, J., Merten, N., Poplimont, H., Busch-Nentwich, E.M., Williams, S., Kotsi, C., Kostenis, E., Sarris, M. (2019) Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish. Nature communications. 10:5166
- Zuñiga-Traslaviña, C., Bravo, K., Reyes, A.E., Feijóo, C.G. (2017) Cxcl8b and Cxcr2 Regulate Neutrophil Migration through Bloodstream in Zebrafish. Journal of immunology research. 2017:6530531
- de Oliveira, S., Boudinot, P., Calado, Â., Mulero, V. (2015) Duox1-Derived H2O2 Modulates Cxcl8 Expression and Neutrophil Recruitment via JNK/c-JUN/AP-1 Signaling and Chromatin Modifications. Journal of immunology (Baltimore, Md. : 1950). 194(4):1523-33
- de Oliveira, S., Lopez-Muñoz, A., Martínez-Navarro, F.J., Galindo-Villegas, J., Mulero, V., Calado, A. (2015) Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium. Developmental and comparative immunology. 49:44-48
- Elks, P.M., van der Vaart, M., van Hensbergen, V., Schutz, E., Redd, M.J., Murayama, E., Spaink, H.P., Meijer, A.H. (2014) Mycobacteria Counteract a TLR-Mediated Nitrosative Defense Mechanism in a Zebrafish Infection Model. PLoS One. 9:e100928
- de Oliveira, S., Reyes-Aldasoro, C.C., Candel, S., Renshaw, S.A., Mulero, V., and Calado, A. (2013) Cxcl8 (IL-8) Mediates Neutrophil Recruitment and Behavior in the Zebrafish Inflammatory Response. Journal of immunology (Baltimore, Md. : 1950). 190(8):4349-59
1 - 6 of 6
Show