Morpholino
MO1-il6st
- ID
- ZDB-MRPHLNO-140620-3
- Name
- MO1-il6st
- Previous Names
-
- gpl130-MO (1)
- Target
- Sequence
-
5' - ACAGCCAATGATGTGAAGTGTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-il6st
No data available
Phenotype
Phenotype resulting from MO1-il6st
No data available
Phenotype of all Fish created by or utilizing MO1-il6st
1 - 5 of 5
Citations
- Ellett, F., Pazhakh, V., Pase, L., Benard, E.L., Weerasinghe, H., Azabdaftari, D., Alasmari, S., Andrianopoulos, A., Lieschke, G.J. (2018) Macrophages protect Talaromyces marneffei conidia from myeloperoxidase-dependent neutrophil fungicidal activity during infection establishment in vivo. PLoS pathogens. 14:e1007063
- Elsaeidi, F., Bemben, M.A., Zhao, X.F., and Goldman, D. (2014) Jak/Stat signaling stimulates zebrafish optic nerve regeneration and overcomes the inhibitory actions of Socs3 and Sfpq. The Journal of neuroscience : the official journal of the Society for Neuroscience. 34(7):2632-2644
- Zhao, X.F., Wan, J., Powell, C., Ramachandran, R., Myers, M.G., Goldman, D. (2014) Leptin and IL-6 Family Cytokines Synergize to Stimulate Müller Glia Reprogramming and Retina Regeneration. Cell Reports. 9(1):272-84
1 - 3 of 3
Show