Morpholino

MO1-cspp1b

ID

ZDB-MRPHLNO-140317-7

Name

MO1-cspp1b

Previous Names

Cspp1b ex2i2 (1)

Target

cspp1b (1)

Sequence

5' - TGCAAACAGAACTCTACCTTGCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cspp1b

No data available

Phenotype

Phenotype resulting from MO1-cspp1b

No data available

Phenotype of all Fish created by or utilizing MO1-cspp1b

Phenotype	Fish	Conditions	Figures
brain hydrocephalic, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
neurocranial trabecula hypoplastic, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
fourth ventricle dilated, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
neurocranial trabecula aplastic, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
tectal ventricle dilated, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
proximal straight tubule cystic, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. S2 from Tuz et al., 2014
pharyngeal arch 3-7 decreased length, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
whole organism curved, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
ventricular system dilated, abnormal	WT + MO1-cspp1a + MO1-cspp1b	standard conditions	Fig. 2 from Tuz et al., 2014
whole organism curved, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014
fourth ventricle dilated, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014
neurocranial trabecula hypoplastic, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014
pharyngeal arch 3-7 decreased length, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014
tectal ventricle dilated, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014
proximal straight tubule cystic, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. S2 from Tuz et al., 2014
brain hydrocephalic, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014
neurocranial trabecula aplastic, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014
ventricular system dilated, abnormal	WT + MO1-cspp1b + MO2-cspp1a	standard conditions	Fig. 2 from Tuz et al., 2014

Citations