Morpholino
MO2-pdgfra
- ID
- ZDB-MRPHLNO-140310-12
- Name
- MO2-pdgfra
- Previous Names
-
- pdgfra spl MO (1)
- Target
- Sequence
-
5' - TTCGAGACATCTGCAAGGAGATATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pdgfra
No data available
Phenotype
Phenotype resulting from MO2-pdgfra
No data available
Phenotype of all Fish created by or utilizing MO2-pdgfra
1 - 3 of 3
Citations
- Murayama, E., Vivier, C., Schmidt, A., Herbomel, P. (2023) Alcam-a and Pdgfr-α are essential for the development of sclerotome-derived stromal cells that support hematopoiesis. Nature communications. 14:11711171
- French, C.R., Seshadri, S., Destefano, A.L., Fornage, M., Arnold, C.R., Gage, P.J., Skarie, J.M., Dobyns, W.B., Millen, K.J., Liu, T., Dietz, W., Kume, T., Hofker, M., Emery, D.J., Childs, S.J., Waskiewicz, A.J., Lehmann, O.J. (2014) Mutation of FOXC1 and PITX2 induces cerebral small-vessel disease. J. Clin. Invest.. 124(11):4877-81
- Kartopawiro, J., Bower, N.I., Karnezis, T., Kazenwadel, J., Betterman, K.L., Lesieur, E., Koltowska, K., Astin, J., Crosier, P., Vermeren, S., Achen, M.G., Stacker, S.A., Smith, K.A., Harvey, N.L., François, M., and Hogan, B.M. (2014) Arap3 is dysregulated in a mouse model of hypotrichosis-lymphedema-telangiectasia and regulates lymphatic vascular development. Human molecular genetics. 23(5):1286-97
1 - 3 of 3
Show