Morpholino

MO2-klhl41a

ID
ZDB-MRPHLNO-140213-5
Name
MO2-klhl41a
Previous Names
None
Target
Sequence
5' - ATGTGGTAGAAACTTACTCGACATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klhl41a
No data available
Phenotype
Phenotype resulting from MO2-klhl41a
Phenotype Fish Figures
eye decreased size, abnormal WT + MO2-klhl41a Fig. 3 from Gupta et al., 2013
pericardium edematous, abnormal WT + MO2-klhl41a Fig. 3 from Gupta et al., 2013
skeletal muscle decreased size, abnormal WT + MO2-klhl41a Fig. 4 from Gupta et al., 2013
skeletal muscle refractivity, abnormal WT + MO2-klhl41a Fig. 3 from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal WT + MO2-klhl41a Fig. 4 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal WT + MO2-klhl41a Fig. S7 from Gupta et al., 2013
skeletal muscle Z disc increased thickness, abnormal WT + MO2-klhl41a Fig. 4 from Gupta et al., 2013
thigmotaxis disrupted, abnormal WT + MO2-klhl41a Fig. SMovie4 from Gupta et al., 2013
whole organism dead, abnormal WT + MO2-klhl41a Fig. 3 from Gupta et al., 2013
whole organism decreased thickness, abnormal WT + MO2-klhl41a Fig. 3 from Gupta et al., 2013
Phenotype of all Fish created by or utilizing MO2-klhl41a
Phenotype Fish Conditions Figures
skeletal muscle refractivity, abnormal WT + MO2-klhl41a standard conditions Fig. 3 from Gupta et al., 2013
whole organism decreased thickness, abnormal WT + MO2-klhl41a standard conditions Fig. 3 from Gupta et al., 2013
pericardium edematous, abnormal WT + MO2-klhl41a standard conditions Fig. 3 from Gupta et al., 2013
eye decreased size, abnormal WT + MO2-klhl41a standard conditions Fig. 3 from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal WT + MO2-klhl41a standard conditions Fig. 4 from Gupta et al., 2013
skeletal muscle Z disc increased thickness, abnormal WT + MO2-klhl41a standard conditions Fig. 4 from Gupta et al., 2013
thigmotaxis disrupted, abnormal WT + MO2-klhl41a standard conditions Fig. SMovie4 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal WT + MO2-klhl41a standard conditions Fig. S7 from Gupta et al., 2013
skeletal muscle decreased size, abnormal WT + MO2-klhl41a standard conditions Fig. 4 from Gupta et al., 2013
whole organism dead, abnormal WT + MO2-klhl41a standard conditions Fig. 3 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
whole organism swimming behavior decreased process quality, abnormal AB + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
muscle cell immature, abnormal AB + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
skeletal muscle disorganized, abnormal AB + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere immature, abnormal AB + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere decreased length, abnormal AB + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
pericardium edematous, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 3 from Gupta et al., 2013
trunk curved, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 3 from Gupta et al., 2013
skeletal muscle sarcomere absent, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 4 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. S7 from Gupta et al., 2013
whole organism dead, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 3 from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 4 from Gupta et al., 2013
whole organism decreased size, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 3 from Gupta et al., 2013
eye decreased size, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 3 from Gupta et al., 2013
skeletal muscle decreased size, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. 4 from Gupta et al., 2013
thigmotaxis disrupted, abnormal WT + MO2-klhl41a + MO2-klhl41b standard conditions Fig. SMovie4 from Gupta et al., 2013
skeletal muscle sarcomere length, ameliorated AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
muscle cell maturity, ameliorated AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere organization quality, ameliorated AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
whole organism swimming behavior process quality, ameliorated AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere decreased length, abnormal AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b control Fig. 5 from Jirka et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.