Morpholino

MO1-mybpc1

ID
ZDB-MRPHLNO-131230-5
Name
MO1-mybpc1
Previous Names
None
Target
Sequence
5' - TATCATCTGAACAGAGACAGAGAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mybpc1
No data available
Phenotype
Phenotype resulting from MO1-mybpc1
Phenotype Fish Figures
axis curved ventral, abnormal WT + MO1-mybpc1 Fig. 2 from Ha et al., 2013
hatching delayed, abnormal WT + MO1-mybpc1 Fig. 3 from Ha et al., 2013
slow muscle cell has fewer parts of type slow muscle cell myofibril, abnormal WT + MO1-mybpc1 Fig. 4 from Ha et al., 2013
slow muscle cell myofibril decreased size, abnormal WT + MO1-mybpc1 Fig. 4 from Ha et al., 2013
slow muscle cell myofibril disorganized, abnormal WT + MO1-mybpc1 Fig. 4 from Ha et al., 2013
slow muscle cell myosin filament disorganized, abnormal WT + MO1-mybpc1 Fig. 4 from Ha et al., 2013
slow muscle cell sarcomere decreased amount, abnormal WT + MO1-mybpc1 Fig. 4 from Ha et al., 2013
slow muscle cell sarcomere malformed, abnormal WT + MO1-mybpc1 Fig. 4 from Ha et al., 2013
slow muscle cell striated muscle thin filament disorganized, abnormal WT + MO1-mybpc1 Fig. 4 from Ha et al., 2013
slow-twitch skeletal muscle fiber contraction decreased process quality, abnormal WT + MO1-mybpc1 Fig. 3 from Ha et al., 2013
taxis decreased process quality, abnormal WT + MO1-mybpc1 Fig. 3 from Ha et al., 2013
thigmotaxis decreased process quality, abnormal WT + MO1-mybpc1 Fig. 3 from Ha et al., 2013
whole organism decreased life span, abnormal WT + MO1-mybpc1 Fig. 3 from Ha et al., 2013
Phenotype of all Fish created by or utilizing MO1-mybpc1
Phenotype Fish Conditions Figures
axis curved ventral, abnormal WT + MO1-mybpc1 standard conditions Fig. 2 from Ha et al., 2013
taxis decreased process quality, abnormal WT + MO1-mybpc1 standard conditions Fig. 3 from Ha et al., 2013
slow muscle cell has fewer parts of type slow muscle cell myofibril, abnormal WT + MO1-mybpc1 standard conditions Fig. 4 from Ha et al., 2013
slow muscle cell sarcomere decreased amount, abnormal WT + MO1-mybpc1 standard conditions Fig. 4 from Ha et al., 2013
slow muscle cell sarcomere malformed, abnormal WT + MO1-mybpc1 standard conditions Fig. 4 from Ha et al., 2013
slow-twitch skeletal muscle fiber contraction decreased process quality, abnormal WT + MO1-mybpc1 standard conditions Fig. 3 from Ha et al., 2013
hatching delayed, abnormal WT + MO1-mybpc1 standard conditions Fig. 3 from Ha et al., 2013
slow muscle cell striated muscle thin filament disorganized, abnormal WT + MO1-mybpc1 standard conditions Fig. 4 from Ha et al., 2013
slow muscle cell myofibril disorganized, abnormal WT + MO1-mybpc1 standard conditions Fig. 4 from Ha et al., 2013
whole organism decreased life span, abnormal WT + MO1-mybpc1 standard conditions Fig. 3 from Ha et al., 2013
thigmotaxis decreased process quality, abnormal WT + MO1-mybpc1 standard conditions Fig. 3 from Ha et al., 2013
slow muscle cell myosin filament disorganized, abnormal WT + MO1-mybpc1 standard conditions Fig. 4 from Ha et al., 2013
slow muscle cell myofibril decreased size, abnormal WT + MO1-mybpc1 standard conditions Fig. 4 from Ha et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.