Morpholino

MO3-otx2b

ID

ZDB-MRPHLNO-131230-2

Name

MO3-otx2b

Previous Names

MO3-otx2
otx2-SB (1)

Target

otx2b (1)

Sequence

5' - TGAGTTGAAAGATGCGTACCTGTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-otx2b

No data available

Phenotype

Phenotype resulting from MO3-otx2b

Phenotype	Fish	Figures
ceratobranchial cartilage curved, abnormal	WT + MO3-otx2b	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage shortened, abnormal	WT + MO3-otx2b	Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal	WT + MO3-otx2b	Fig. 3 from Chassaing et al., 2012
mandibular arch skeleton shortened, abnormal	WT + MO3-otx2b	Fig. 3 from Chassaing et al., 2012

Phenotype of all Fish created by or utilizing MO3-otx2b

Phenotype	Fish	Conditions	Figures
ceratobranchial cartilage shortened, abnormal	WT + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal	WT + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal	WT + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
mandibular arch skeleton shortened, abnormal	WT + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratohyal cartilage orientation axis, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage disorganized, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage shortened, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
chondrocranium cartilage malformed, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
Meckel's cartilage shape, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
eye fused with eye, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage malformed, abnormal	WT + MO1-pgap1 + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal	WT + MO2-msx1a + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage shortened, abnormal	WT + MO2-msx1a + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal	WT + MO2-msx1a + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
chondrocranium cartilage malformed, abnormal	WT + MO2-msx1a + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage malformed, abnormal	WT + MO2-msx1a + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
pharyngeal arch cartilage malformed, abnormal	WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
eye decreased size, abnormal	WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage curved, abnormal	WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
ceratobranchial cartilage shortened, abnormal	WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012
chondrocranium cartilage malformed, abnormal	WT + MO1-prrx1a + MO1-prrx1b + MO3-otx2b	standard conditions	Fig. 3 from Chassaing et al., 2012

Citations