Morpholino

MO1-bbs10

ID
ZDB-MRPHLNO-131206-1
Name
MO1-bbs10
Previous Names
None
Target
Sequence
5' - TGCTGCTGCATCTACACACATAAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bbs10
No data available
Phenotype
Phenotype resulting from MO1-bbs10
Phenotype Fish Figures
cell migration involved in gastrulation disrupted, abnormal WT + MO1-bbs10 Fig. S3 with image from Zaghloul et al., 2010
convergent extension process quality, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2014
eye decreased size, abnormal WT + MO1-bbs10 Fig. 2 from Putoux et al., 2011
gastrulation disrupted, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2016
Fig. S4 with image from Zaghloul et al., 2010
head decreased size, abnormal WT + MO1-bbs10 Fig. 2 from Putoux et al., 2011
notochord increased width, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
Fig. 2 from Stoetzel et al., 2006
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2014
somite amorphous, abnormal WT + MO1-bbs10 Fig. 2 from Stoetzel et al., 2006
somite asymmetrical, abnormal WT + MO1-bbs10 Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs10 Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
somite shape, abnormal WT + MO1-bbs10 Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs10 Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
Fig. 2 from Stoetzel et al., 2006
whole organism dorsal side decreased thickness, abnormal WT + MO1-bbs10 Fig. 2 from Stoetzel et al., 2006
Phenotype of all Fish created by or utilizing MO1-bbs10
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
Fig. 2 from Stoetzel et al., 2006
somite shape, abnormal WT + MO1-bbs10 standard conditions Fig. 2 from Putoux et al., 2011
somite increased length, abnormal WT + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
cell migration involved in gastrulation disrupted, abnormal WT + MO1-bbs10 standard conditions Fig. S3 with image from Zaghloul et al., 2010
eye decreased size, abnormal WT + MO1-bbs10 standard conditions Fig. 2 from Putoux et al., 2011
pronephros development disrupted, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2014
convergent extension process quality, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2014
head decreased size, abnormal WT + MO1-bbs10 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
Fig. 2 from Stoetzel et al., 2006
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2014
somite asymmetrical, abnormal WT + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
gastrulation disrupted, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2016
Fig. S4 with image from Zaghloul et al., 2010
somite increased width, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Putoux et al., 2011
Fig. S4 with image from Zaghloul et al., 2010
whole organism dorsal side decreased thickness, abnormal WT + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-bbs10 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO1-bbs10 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
cell detached from neural tube, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
notochord increased width, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs10 + MO1-mkks standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs10 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO1-bbs10 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO1-bbs10 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-bbs10 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
convergent extension process quality, abnormal WT + MO1-bbs10 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs10 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO1-bbs10 + MO2-nphp1 standard conditions Fig. 5 from Lindstrand et al., 2014
proximal convoluted tubule decreased size, abnormal WT + MO1-bbs10 + MO3-bbs5 standard conditions Fig. 5 from Lindstrand et al., 2016
proximal convoluted tubule decreased area, abnormal WT + MO1-bbs10 + MO3-bbs5 standard conditions Fig. 5 from Lindstrand et al., 2016
gastrulation disrupted, abnormal WT + MO1-bbs10 + MO3-bbs5 standard conditions Fig. 5 from Lindstrand et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.