Morpholino
MO1-esr2b
- ID
- ZDB-MRPHLNO-131203-3
- Name
- MO1-esr2b
- Previous Names
-
- Exon 3 Intron 3 (1)
- Target
- Sequence
-
5' - TTGACCATGAGCATTACCTTGAATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-esr2b
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| runx1 |
Fig. 2 
from Carroll et al., 2014 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-esr2b
No data available
Phenotype of all Fish created by or utilizing MO1-esr2b
1 - 3 of 3
Citations
- Wesselman, H.M., Gatz, A.E., Pfaff, M.R., Arceri, L., Wingert, R.A. (2023) Estrogen Signaling Influences Nephron Segmentation of the Zebrafish Embryonic Kidney. Cells. 12(4):
- Li, X., Wang, L., Qin, X., Chen, X., Li, L., Huang, Z., Zhang, W., Liu, W. (2022) Estrogens revert neutrophil hyperplasia by inhibiting Hif1α-cMyb pathway in zebrafish myelodysplastic syndromes models. Cell death discovery. 8:323
- Carroll, K.J., Esain, V., Garnaas, M.K., Cortes, M., Dovey, M.C., Nissim, S., Frechette, G.M., Liu, S.Y., Kwan, W., Cutting, C.C., Harris, J.M., Gorelick, D.A., Halpern, M.E., Lawson, N.D., Goessling, W., North, T.E. (2014) Estrogen defines the dorsal-ventral limit of VEGF regulation to specify the location of the hemogenic endothelial niche. Developmental Cell. 29:437-53
- Griffin, L.B., January, K.E., Ho, K.W., Cotter, K.A., and Callard, G.V. (2013) Morpholino Mediated Knockdown of ERalpha, ERbetaa and ERbetab mRNAs in Zebrafish (Danio rerio) Embryos Reveals Differential Regulation of Estrogen-Inducible Genes. Endocrinology. 154(11):4158-69
1 - 4 of 4
Show