Morpholino

MO1-ptmab

ID
ZDB-MRPHLNO-131125-4
Name
MO1-ptmab
Previous Names
None
Target
Sequence
5' - CGGAGTCAACCTTTGCATCTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptmab
Expressed Gene Anatomy Figures
ptmab Fig. 3 from Emmanouilidou et al., 2013
Phenotype
Phenotype resulting from MO1-ptmab
Phenotype Fish Figures
caudal fin bent, abnormal WT + MO1-ptmab Fig. 2 from Emmanouilidou et al., 2013
caudal fin curved, abnormal WT + MO1-ptmab Fig. 2 from Emmanouilidou et al., 2013
caudal fin apoptotic process increased occurrence, abnormal WT + MO1-ptmab Fig. 5 from Emmanouilidou et al., 2013
cell population proliferation decreased occurrence, abnormal WT + MO1-ptmab Fig. 4 from Emmanouilidou et al., 2013
head decreased size, abnormal WT + MO1-ptmab Fig. 2 from Emmanouilidou et al., 2013
head apoptotic process increased occurrence, abnormal WT + MO1-ptmab Fig. 5 from Emmanouilidou et al., 2013
pericardium edematous, abnormal WT + MO1-ptmab Fig. 2 from Emmanouilidou et al., 2013
spinal cord bent, abnormal WT + MO1-ptmab Fig. 2 from Emmanouilidou et al., 2013
trunk curved, abnormal WT + MO1-ptmab Fig. 2 from Emmanouilidou et al., 2013
whole organism decreased size, abnormal WT + MO1-ptmab Fig. 2 from Emmanouilidou et al., 2013
Phenotype of all Fish created by or utilizing MO1-ptmab
Phenotype Fish Conditions Figures
caudal fin bent, abnormal WT + MO1-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
cell population proliferation decreased occurrence, abnormal WT + MO1-ptmab standard conditions Fig. 4 from Emmanouilidou et al., 2013
caudal fin curved, abnormal WT + MO1-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
spinal cord bent, abnormal WT + MO1-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
pericardium edematous, abnormal WT + MO1-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
head decreased size, abnormal WT + MO1-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
head apoptotic process increased occurrence, abnormal WT + MO1-ptmab standard conditions Fig. 5 from Emmanouilidou et al., 2013
trunk curved, abnormal WT + MO1-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
whole organism decreased size, abnormal WT + MO1-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
caudal fin apoptotic process increased occurrence, abnormal WT + MO1-ptmab standard conditions Fig. 5 from Emmanouilidou et al., 2013
caudal fin curved, abnormal WT + MO1-ptmab + MO2-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
spinal cord bent, abnormal WT + MO1-ptmab + MO2-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
pericardium edematous, abnormal WT + MO1-ptmab + MO2-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
trunk curved, abnormal WT + MO1-ptmab + MO2-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
head decreased size, abnormal WT + MO1-ptmab + MO2-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
whole organism decreased size, abnormal WT + MO1-ptmab + MO2-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
caudal fin bent, abnormal WT + MO1-ptmab + MO2-ptmab standard conditions Fig. 2 from Emmanouilidou et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.