Morpholino

MO1-marcksa

ID
ZDB-MRPHLNO-131003-1
Name
MO1-marcksa
Previous Names
  • MAT (1)
Target
Sequence
5' - CTGTTTTTGTGAATTGCGCTCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-marcksa
No data available
Phenotype
Phenotype resulting from MO1-marcksa
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-marcksa Fig. 3Fig. 4Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksa Fig. 3Fig. 4Fig. 6 from Ott et al., 2011
eye decreased size, abnormal WT + MO1-marcksa Fig. 7 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa + MO4-tp53 Fig. 3Fig. 4Fig. 6Fig. 7 from Ott et al., 2011
gill filament malformed, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
gill filament chondrocyte absent, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
gill filament epithelium disorganized, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa Fig. 6 from Ott et al., 2011
post-vent region decreased length, abnormal WT + MO1-marcksa Fig. 3Fig. 4 from Ott et al., 2011
respiratory system development disrupted, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
retina layer formation disrupted, abnormal WT + MO1-marcksa Fig. 7 from Ott et al., 2011
retinal neural layer absent, abnormal WT + MO1-marcksa Fig. 7 from Ott et al., 2011
skeletal muscle cell curved, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
skeletal muscle cell nucleus increased amount, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
skeletal muscle cell nucleus increased diameter, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
skeletal muscle cell differentiation disrupted, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
whole organism curved, abnormal WT + MO1-marcksa Fig. 3Fig. 4 from Ott et al., 2011
whole organism dead, abnormal WT + MO1-marcksa Fig. 4 from Ott et al., 2011
Phenotype of all Fish created by or utilizing MO1-marcksa
Phenotype Fish Conditions Figures
gill filament epithelium disorganized, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
skeletal muscle cell curved, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 3Fig. 4Fig. 6 from Ott et al., 2011
skeletal muscle cell nucleus increased diameter, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
gill filament chondrocyte absent, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
respiratory system development disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
skeletal muscle cell differentiation disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
skeletal muscle cell nucleus increased amount, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa standard conditions Fig. 3Fig. 4Fig. 6Fig. 7 from Ott et al., 2011
whole organism dead, abnormal WT + MO1-marcksa standard conditions Fig. 4 from Ott et al., 2011
retina layer formation disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 7 from Ott et al., 2011
post-vent region decreased length, abnormal WT + MO1-marcksa standard conditions Fig. 3Fig. 4 from Ott et al., 2011
whole organism curved, abnormal WT + MO1-marcksa standard conditions Fig. 3Fig. 4 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksa standard conditions Fig. 3Fig. 4Fig. 6 from Ott et al., 2011
gill filament malformed, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
retinal neural layer absent, abnormal WT + MO1-marcksa standard conditions Fig. 7 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa standard conditions Fig. 6 from Ott et al., 2011
eye decreased size, abnormal WT + MO1-marcksa standard conditions Fig. 7 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
whole organism ventral region szl expression decreased amount, abnormal marcksbihb199/ihb199 + MO1-marcksa + MO1-marcksl1a + MO2-marcksl1b standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksa + MO1-marcksl1a + MO2-marcksl1b standard conditions Fig 7 with image from Ye et al., 2019
Citations