Morpholino
MO5-cyp26a1
- ID
- ZDB-MRPHLNO-131002-2
- Name
- MO5-cyp26a1
- Previous Names
- None
- Target
- Sequence
-
5' - TAAAAATAATACACTACCTGCAAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-cyp26a1
No data available
Phenotype
Phenotype resulting from MO5-cyp26a1
No data available
Phenotype of all Fish created by or utilizing MO5-cyp26a1
from 1 - 5 of 52 Show all
Citations
- Song, Y.C., Dohn, T.E., Rydeen, A.B., Nechiporuk, A.V., Waxman, J.S. (2019) HDAC1-mediated repression of the retinoic acid-responsive gene ripply3 promotes second heart field development. PLoS Genetics. 15:e1008165
- Rydeen, A.B., Waxman, J.S. (2016) Cyp26 Enzymes Facilitate Second Heart Field Progenitor Addition and Maintenance of Ventricular Integrity. PLoS Biology. 14:e2000504
- Rydeen, A., Voisin, N., D'Aniello, E., Ravisankar, P., Devignes, C.S., Waxman, J.S. (2015) Excessive feedback of Cyp26a1 promotes cell non-autonomous loss of retinoic acid signaling. Developmental Biology. 405(1):47-55
- Rydeen, A.B., Waxman, J.S. (2014) Cyp26 enzymes are required to balance the cardiac and vascular lineages within the anterior lateral plate mesoderm. Development (Cambridge, England). 141:1638-48
- D'Aniello, E., Rydeen, A.B., Anderson, J.L., Mandal, A., and Waxman, J.S. (2013) Depletion of Retinoic Acid Receptors Initiates a Novel Positive Feedback Mechanism that Promotes Teratogenic Increases in Retinoic Acid. PLoS Genetics. 9(8):e1003689
- Mandal, A., Rydeen, A., Anderson, J., Sorrell, M.R., Zygmunt, T., Torres-Vazquez, J., and Waxman, J.S. (2013) Transgenic retinoic acid sensor lines in zebrafish indicate regions of available embryonic retinoic acid. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(8):989-1000
1 - 6 of 6
Show